Effect of cryopreservation on the efficiency of exogenous gene, genetic transformation and expression level of Arabidopsis thaliana

Zhongai Li¹ · Yaqiong Du¹ · Zicheng Wang*¹

¹Henan University, College of Life Science, Plant Germplasm Resources and Genetic Laboratory, Kaifeng, Henan, China

*Corresponding author: wzc@henu.edu.cn

Financial support: Financial support from the National Science Foundation of China (#30900973, #31171982).

Keywords: Arabidopsis thaliana; cryopreservation; real-time PCR; transformation efficiency.

Background: Cryopreservation refers to the storage of a living organism at ultra-low-temperature for long-term preservation of plant germplasm. The effect of cryopreservation on the efficiency of exogenous gene genetic transformation and expression level were studied herein. In this work, transgenic Arabidopsis thaliana were successfully conserved in vitro by cryopreservation methods.

Results: The effects of osmotic stress due to cryoprotectants during pretreatment and of storage at -196ºC on the stability, the efficiency of genetic transformation and the expression level of exogenous gene were analyzed in Arabidopsis. The results showed that there had not any significant increasing in the efficiency of genetic transformation after cryopreservation, and our observation was not in agreement with earlier reports. Transgenic Arabidopsis lines over-expressing ATOST1 gene were used for the real-time PCR analysis, and the result indicated that the expression of the ATOST1 gene was up-regulated about 2.4-fold in the transgenic seedlings tissues retrieved from cryopreservation than those non-cryopreserved counterparts.

Conclusions： Cryopreservation could improve the expression of exogenous gene, however, could not promote the genetic transformation obviously.

Cryopreservation strategies could be successfully employed to reduce genetic variation and could be an important tool for the long-term preservation of germplasm (Elleuch et al. 1998). However, the rapid plunge into liquid nitrogen of unprotected cells could cause selection of physiological, epigenetic or genetic variants (Moukadiri et al. 1999).

Many studies have been conducted to test the genetic stability of cryopreserved plant materials. SSCP analysis and transient gene expression experiments indicated the stable maintenance and normal expression of the GUS gene in transgenic pear shoots retrieved from in vitro conservation (Hao et al. 2005). Rice calli that had been directly stored in liquid nitrogen also demonstrated a higher competence for genetic transformation than their unfrozen counterparts, as indicated by the transient gene expression levels obtained after particle bombardment (Moukadiri et al. 1999). Cryopreservation may usually induce DNA alterations, especially at the epigenetic level accomplished by altered DNA methylation status. Hao et al. (2001) and Hao et al. (2002) found some demethylated sites after cryopreservation by vitrification in strawberry and apple.

In eukaryotes, particularly, higher plants, the DNA methylation of promoter regions usually inhibit transcription. But methylation in coding regions does not generally affect gene expression (Chan et al. 2005). The DNA methylation status of the treatment samples varied during the processes of cryopreservation, and both de novo methylation and demethylation were observed. Furthermore, the samples treated in liquid nitrogen showed more demethylation sites than those not treated in liquid nitrogen determined by methylation-sensitive amplification polymorphism technique in Arabidopsis (Wang and He, 2009).

The present study aimed to determine whether the cryopreservation methods affecting the efficiency of genetic transformation and the level of exogenous gene expression in Arabidopsis thaliana.

Plant materials, growth conditions, and transformation

The OST1-pGEX-2TK constructs were introduced into Agrobacterium tumefaciens strain GV3101, Arabidopsis thaliana ecotype Columbia was used as the wild type for transformation employing the standard Agrobacterium-mediated floral dip method (Clough and Bent, 1998), and seeds later were harvested (for gene overexpression assays). The constructs were obtained from the Laboratory of Plant Stress Biology (Henan University). Putative transformants were selected by planting seeds on Murashige and Skoog (1962) (MS) basal medium supplied with 30 mg ml^-1 of hygromycin, then the hygromycin -resistant seedlings were transferred to soil at 12 days after germination and placed in a growth chamber at 22ºC under a 16-hrs-light/8-hrs-dark photoperiod and 70% RH (Jiang et al. 2006). Seeds were harvested separately from individual plants.

Cryopreservation procedures

Two days old seedlings were immersed in loading solution (MS liquid medium + 2 M glycerol + 0.4 M sucrose) for 20 min at room temperature (1.0 ml for 30-40 seedlings in one 2.0 ml cryovial). Loading solution was then removed from the cryovial and rapidly replaced by filtered sterilized cryoprotective solution PVS2 (30% w/v glycerol, 15% w/v ethylene glycol and 15% w/v Dimethylsulfoxide in liquid MS medium supplemented with 0.4 M sucrose) and left at 0ºC for 50 min and we named those procedures as pre-treatment. For cryopreservation treatment, the cryovials were then rapidly immersed in liquid nitrogen for at least 1 hr. Thawing was carried out by immersing cryovials in a water bath at 40ºC for 60-90 sec, and cryovials were shaken vigorously. Subsequently, PVS2 solution was removed and replaced with unloading solution (MS liquid medium + 1.2 M sucrose) for 40 min, and the unloading solution was replaced once every 10 min. The seedlings were then cultured on MS medium and maintained under growth conditions as above. The cryopreserved samples had been done with exactly as above steps. Some seedlings were treated only with the pre-treatment (loading and cryoprotection) and then employed unloading and re-culture, which hadn’t been cryostoraged in liquid nitrogen and thawed in 40ºC water bath, were used as parallel experiments, and non-treatment samples used as control.

DNA extraction and PCR analysis

When all the seedlings grew at more than 8 leaves, 1-2 leaves of each seedlings were used to extract DNA with CTAB method (Dellaporta et al. 1983) for the next molecular analysis.

Hygromycin-resistant plants were reexamined to eliminate pseudo transgenic lines by PCR amplification with the following primer pairs: sense: 5’ AAGATGTTGGCGACCTCGT ATTGG3’, antisense: 5’TTCGACAGCGTCTCCGACCTGAT3’, these primer pairs are expected to amplify a 598-bp fragment of the OST1 gene encoding sequence. PCR amplification was performed in a 25 μl volume containing 50 ng template DNA, 2.5 μl 10 x PCR buffer, 2.0 mmol L^-1 MgCl2, 120 μmol L^-1 dNTPs, 1.25 U of Taq DNA polymerase, 0.2 μmol L^-1 Primer 1 and Primer 2 each. The PCR reaction was performed in a PTC-100 machine, samples were heated to 94ºC for 5 min and then amplified in a DNA thermocycler by 30 cycles of 30 sec annealing at 56ºC, 1 min elongation at 72ºC and 30 sec denaturation at 94ºC, followed by 1 cycle of 10 min at 72ºC. Electrophoretic separation of the amplified DNA fragment was carried out in 1.0% agarose gel containing 0.5 mg mL^-1 ethidium bromide. The gels were visualized and photographed with UV light. Positive samples lines were used for the following analysis.

Statistical analysis

Data of the transformation efficiency of the Arabidopsis exogenous gene after cryopreservation, pre-treatment and untreated were submitted to analysis of variance using SPSS v11.5 software.

Reverse transcription PCR and real-time PCR

Total RNA was isolated from 200 mg 15 days-old samples seedlings (cryopreserved, pre-treatment and control) with Trizol reagent. 5 μg of total RNA were used in reverse transcription with Moloney murine leukemia virus reverse transcriptase (Takara). Reverse transcription conditions were as follows: at 70ºC for 5 min, at 42ºC for 1 hr, and at 95ºC for 5 min. The cDNA thereby obtained was used for RT-PCR and real-time quantitative RT-PCR on a Rotor-Gene 3000 apparatus (Corbett Research) and repeated experiments three times. Real-time PCR amplification with the following primer pairs: the forward primer of ost1: 5’AGTTGCGAGATTGATGAG3’ and the reverse primer: 5’GGCTAAATGGGTTGGTGT3’, Actin2-F: 5’ATTACCCGATGGGCAAGT CA3’, Actin2-R: 5’CACAAACGAGGGCTGGAACA3’. Cycling conditions were as follows: 30 sec at 95ºC, 40 cycles of 15 sec at 95ºC, 20 sec at 56ºC, and 30 sec at 72ºC; 1 min at 95ºC, 30 sec at 55ºC, 30 sec at 95ºC, and the following melting-curve program (56 to 99ºC, with a 5-sec hold at each temperature). Specific cDNA was quantified with a standard curve based on the known amounts of amplified target gene fragments. The mean value of three replicates was normalized using Actin2 as the internal control. Ct values were analyzed using Excel (Microsoft).

Survival and the plant development

After cryostorage, the ability of the seedlings to survive decreased a little, and the average survival rate reached 94.2%. Twenty days after re-culture, all the plants with treatments did not show morphological alterations as compared with the untreated and unfrozen controls, but in the early development, seedlings after cryostorage in LN grow more slowly than the controls, which are as same as our previous findings (Wang and He, 2009).

Effect of cryopreservation on the efficiency of exogenous gene genetic transformation

Three Arabidopsis seedlings lines (the control, pre-treatment and cryopreservation) were used for transformation after grown 35 days employing the standard Agrobacterium-mediated floral dip method. Transgenic lines resistant to hygromycin B were phenotypically indistinguishable from wild-type lines. PCR amplification of genomic DNA was performed to detect the presence of the exogenous gene. The predicted 598-bp amplified fragment overlapping the major part of the OST1 gene coding sequence and part of the 35S promoter was detected with the same intensity when using DNA extracted from the three Arabidopsis transgenic seedlings lines (Figure 1). The positive control (plasmid 35S::OST1) gave a PCR product of the same size.

The transformation rate, namely, the percentage of the positive seedlings to the total seedlings, was calculated. In the cryopreserved seedlings lines, the number of transgenic positive seedlings was 395 of the total 270175 and giving the transformation rate 0.167% (L-3); in parallel, the transformation rate was 0.150% from the number 440 of transgenic positive seedlings versus the total seedlings 280492 in the pre-treated seedlings lines (L-2); and the transformation rate was 0.141% in the control lines, the number of the transgenic positive seedlings was 463 against the total seedlings 252270 (L-1). (The mean ± standard deviation of eight replicates) (Figure 2). The cryopreserved and pre-treated samples compared with the control, the amount did not allow a statistically significant comparison (p = 0.964) (Table 1). These data showed the efficiency of the exogenous gene transformation was not significantly different among the three lines.

The analysis of expression levels of the exogenous gene in the transgenic seedling tissues

The effect of cryopreservation on the efficiency of genetic transformation and the level of gene expression with respect to an exogenously introduced gene may depend on the locus where the T-DNA was inserted into the chromosome. Therefore, Arabidopsis transgenic positive seedlings lines without any treatment obtained by the standard Agrobacterium-mediated floral dip method were used for following analysis. Determination of the expression levels is conducted using ten independent lines of transgenic Arabidopsis separately. Each of these lines originated from one transgenic seedling, respectively. In each line, a portion of the seeds without any treatment was used as the untreated control, another portion of seeds was used as parallel experiments (with pre-treatment), and the third portion of seeds was cryopreserved in liquid nitrogen for more than 1 hr. Subsequently, total RNA samples were obtained after seeding 15-day from the three Arabidopsis seedlings lines (the control, pre-treatment and cryopreservation) to confirm the level of gene expression. RT-PCR was performed with a pair of primers specific to the OST1 gene. The primer pair produced only one fragment from each cDNA sample.

Real-time PCR analysis (Pfaffl, 2001; Miao et al. 2006) was used to determine whether the expression of exogenous gene was affected by cryopreservation among the control, pre-treatment and cryopreserved samples. Transcript levels are expressed relative to the level of transcripts in the untreated control, which are assumed to be one (Devaiah et al. 2009). This result indicates that cryopreservation affects the level of exogenous gene expression. The level of OST1 gene expression shows enhancement about 2.4-fold after cryopreservation compared with the control and pre-treatment samples (Figure 3), and the level of ATOST1 expression among the three lines has no statistical significance (Table 2).

Early reports have been found that the integrated NPT II gene was stably maintained in cryopreserved-regrown citrus cells without DNA alteration (Kobayashi et al. 1994). Similarly, cryopreservation has no impact on the existence, transcription, and expression of the sam1 gene in opium poppy (Elleuch et al. 1998) and the NPT gene in wheat (Fretz and Lorz, 1995). Recently, the transgenic clones of Beta vulgaris, Nicotiana rustica (Benson and Hamill, 1991), navel orange (Kobayashi et al. 1994), opium poppy (Elleuch et al. 1998), barley and wheat (Fretz and Lorz, 1995), and some medicinal plant species (Yoshimatsu et al. 2000) have been conserved in vitro by cryopreservation.

In this study, transgenic Arabidopsis seedlings were preserved in vitro by cryopreservation, and these transgenic seedlings can be cryopreserved for an unlimited period Wang and He (2009) found DNA methylation status changed in the cryopreserved treatment samples but the phenotypic traits of those plants were normal, including the times of beginning to stalk and flowering, and yield-component traits etc. Our result indicates the efficiency of the exogenous gene transformation was not significantly different among the three Arabidopsis seedlings lines (the control, pre-treatment and cryopreservation) and the expression of the exogenous gene was enhanced in the transgenic seedling tissues retrieved from cryopreserved samples than the non-cryopreserved (Real-time Quantitative RT-PCR). We conclude from our study that none of the steps of the cryopreservation procedures, i.e. osmotic stress due to cryoprotectants, freezing and thawing, affect either the integrity or transcription of the transgene. The mRNA expression these results agree with the studies on transformed Beta vulgaris and Nicotiana rustica (Benson and Hamill, 1991) owing that the T-DNA and biosynthetic stability were maintained after cryopreservation. Some reports showed that cryopreservation induced DNA demethylation (Johnston et al. 2009; Wang and He, 2009), and methylation has effect on the expression of gene (Finnegan et al. 1996; Chan et al. 2005), and it was unknown whether the variation of DNA methylation status was one reason for the present results. Further experiments are required to examine the DNA methylation levels, using a bisulphite sequencing method, and elucidate the relation between the demethylation and the level of exogenous gene expression in cryopreservation plant materials. It is important to accumulate more data for the effect of cryopreservation on the stability of transgene expression with other system, that will contribute to broaden the future application of cryopreservation to diverse genetic resources.

BENSON, E.E. and HAMILL, J.D. (1991). Cryopreservation and post freeze molecular and biosynthetic stability in transformed roots of Beta vulgaris and Nicotiana rustica. Plant Cell, Tissue and Organ Culture, vol. 24, no. 3, p. 163-172. [CrossRef]

CHAN, S.W.L.; HENDERSON, I.R. and JACOBSEN, S.E. (2005). Gardening the genome: DNA methylation in Arabidopsis thaliana. Nature Reviews Genetics, vol. 6, no. 5, p. 351-360. [CrossRef]

CLOUGH, S.J. and BENT, A.F. (1998). Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. The Plant Journal, vol. 16, no. 6, p. 735-743. [CrossRef]

DELLAPORTA, S.L.; WOOD, J. and HICKS, J.B. (1983). A plant DNA minipreparation: Version II. Plant Molecular Biology Reporter, vol. 1, no. 4, p. 19-21. [CrossRef]

DEVAIAH, B.N.; MADHUVANTHI, R.; KARTHIKEYAN, A.S. and RAGHOTHAMA, K.G. (2009). Phosphate starvation responses and Gibberellic acid biosynthesis are regulated by the MYB62 transcription factor in Arabidopsis. Molecular Plant, vol. 2, no. 1, p. 43-58. [CrossRef]

ELLEUCH, H.; GAZEAU, C.; DAVID, H. and DAVID, A. (1998). Cryopreservation does not affect the expression of a foreign sam gene in transgenic Papaver somniferum cells. Plant Cell Reports, vol. 18, no. 1-2, p. 94-98. [CrossRef]

FINNEGAN, E.J.; PEACOCK, W.J. and DENNIS, E.S. (1996). Reduced DNA methylation in Arabidopsis thaliana results in abnormal plant development. Proceedings of the National Academy of Sciences of the United States of America, vol. 93, no. 16, p. 8449-8454. [CrossRef]

FRETZ, A. and LORZ, H. (1995). Cryopreservation of in vitro cultures of barley (Hordeum vulgare L. and H. murinum L.) and transgenic cells of wheat (Triticum aestivum L.). Journal of Plant Physiology, vol. 146, no. 4, p. 489-496. [CrossRef]

HAO, Y.J.; LIU, Q.L. and DENG, X.X. (2001). Effect of cryopreservation on apple genetic resources at morphological, chromosomal, and molecular levels. Cryobiology, vol. 43, no. 1, p. 46-53. [CrossRef]

HAO, Y.J.; YOU, C.X. and DENG, X.X. (2002). Analysis of ploidy and the patterns of amplified fragment length polymorphism and methylation sensitive amplified polymorphism in strawberry plants recovered from cryopreservation. Cryo Letters, vol. 23, no. 1, p. 37-46.

HAO, Y.J.; CHENG, Y.J. and DENG, X.X. (2005). Stable maintenance and expression of a foreign gene in transgenic pear shoots retrieved from in vitro conservation. Journal of Plant Physiology, vol. 162, no. 2, p. 237-243. [CrossRef]

JIANG, K.; SCHWARZER, C.; LALLY, E.; ZHANG, S.; RUZIN, S.; MACHEN, T.; REMINGTON, S.J. and FELDMAN, L. (2006). Expression and characterization of a redox-sensing green fluorescent protein (reduction-oxidation-sensitive green fluorescent protein) in Arabidopsis. Plant Physiology, vol. 141, no. 2, p. 397-403. [CrossRef]

JOHNSTON, J.W.; BENSON, E.E. and HARDING, K. (2009). Cryopreservation induces temporal DNA methylation epigenetic changes and differential transcriptional activity in Ribes germplasm. Plant Physiology and Biochemistry, vol. 47, no. 2, p. 123-131. [CrossRef]

KOBAYASHI, S.; SAKAI, A.; OHGAWARA, T. and NAKAMURA, Y. (1994). Stable maintenance of an integrated gene in nucellar cells of navel orange (Citrus sinensis Osb.) under storage in LN₂. Journal of the Japanese Society for Horticultural Science, vol. 63, no. 3, p. 553-558. [CrossRef]

MIAO, Y.C.; DONG, L.V.; WANG, P.C.; WANG, X.C.; CHEN, J.; MIAO, C. and SONG, C.P. (2006). An Arabidopsis glutathione peroxidase function as both a redox transducer and a scavenger in abscisic acid and drought stress responses. The Plant Cell, vol. 18, no. 10, p. 2749-2766. [CrossRef]

MOUKADIRI, O.; LOPES, C.R. and CORNEJO, M.J. (1999). Physiological and genomic variations in rice cells recovered from direct immersion and storage in liquid nitrogen. Physiologia Plantarum, vol. 105, no. 3, p. 442-449. [CrossRef]

MURASHIGE, T. and SKOOG, F. (1962). A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiologia Plantarum, vol. 15, no. 3, p. 473-497. [CrossRef]

PFAFFL, M.W. (2001). A new mathematical model for relative quantification in real-lime RT-PCR. Nucleic Acids Research, vol. 29, no. 9, p. e45. [CrossRef]

WANG, Z.C. and HE, Y.X. (2009). Effect of cryopreservation on the development and DNA methylation patterns of Arabidopsis thaliana. Life Science Journal, vol. 6, no. 1, p. 55-60.

YOSHIMATSU, K.; TOUNO, K. and SHIMOMURA, K. (2000). Cryopreservation of medicinal plant resources: Retention of biosynthetic capabilities in transformed cultures. In: ENGELMANN, F. and TAKAGI, H. eds. Cryopreservation of tropical plant germplasm: Current research progress and application. JIRCAS International Agriculture Series, Tsukuba, Japan. p. 77-88.