Full Text - Molecular cloning, expression pattern, and putative cis-acting elements of a 4-coumarate:CoA ligase gene in bamboo (Neosinocalamus affinis)

Molecular cloning, expression pattern, and putative cis-acting elements of a 4-coumarate:CoA ligase gene in bamboo (Neosinocalamus affinis)

Ying Cao¹ · Shang-lian Hu*¹ · Sheng-xiong Huang¹ · Peng Ren¹ · Xue-qin Lu¹

¹Southwest University of Science and Technology, College of Life Science and Engineering, Mianyang, People’s Republic of China

Financial support: This work was supported by Application-Basic Research foundation of Sichuan Province, P.R. China (05JY029-101).

Keywords: expression pattern, Neosinocalamus affinis, promoter, RACE, RNAi.

Background: 4-coumarate:CoA ligase (4CL) plays an important role at the divergence point from general phenylpropanoid metabolism to several branch pathways. Although 4CL sin higher plants have been extensively studied, little has known about the 4CL gene of bamboo. Results: In current study, a Na4CL gene putative encoding 4-coumarate:CoA ligase (4CL) and its 5’-flanking region were isolated from bamboo (Neosinocalamus affinis) by RACE-PCR and genomic DNA walker, respectively. Na4CL encodes a predicted protein of 557 amino acids, with conserved motifs of adenylate-forming enzymes. Phylogenetic analysis showed that Na4CL shared 62~85% identity with other known plant 4CLs, and cluster closely with some known 4CLs in monocots. Sequence analysis revealed conserved cis-acting elements (Box A and AC-II element) present in the Na4CL promoter. Additionally, a Na4CL RNAi construct was transformed into tobacco. Transgenic tobaccos displayed significant down-expression of endogenesis 4CL and reduced lignin contents. Conclusion: These results contribute to the knowledge of the presence of Na4CL gene and its possible role in phenylpropanoid metabolism.

Bamboos are ancient grass plants that are widely distributed in tropical and subtropical zones in Asia, Africa and America. Because of morphologically and physiologically unique, bamboos have drawn much attention in last few years. Peng et al. (2010) reported 10,608 putative full length cDNAs and nearly 38,000 ESTs generated from Moso bamboo (Phyllostachys heterocycla cv. Pubescens). And there is more than nine thousands ESTs of Dendrocalamus latiflorus in GenBank which are available. These sequence data would be useful for studying the structure and function of bamboo genes. However, different from scattered-born bamboo species such as Dendrocalamus latiflorus and Phyllostachys edulis, Neosinocalamus affinis is a typical sympodial bamboo, and it is widely cultivated in south-western of China as a preferable wood substitute for chemical pulping. However there is little genome data available from Neosinocalamus affinis in public database.

In this paper, we isolated a cDNA putative encoding 4CL and its upstream region from Neosinocalamus affinis by the RACE and genomic DNA walking strategy, respectively. The sequence characteristic, expression pattern, and putative cis-acting elements of the bamboo 4CL gene, designated as Na4CL here, were also reported. Additionally, a Na4CL RNAi construct was transformed into tobacco. Transgenic tobaccos displayed significant down-expression of endogenesis 4CL and reduced lignin content. These results contributed to the knowledge of the presence of Na4CL gene and its possible role in phenylpropanoid metabolism.

Total RNAs from young shoots of Neosinocalamus affinis were extracted with TRIzol reagent (Invitrogen) according to the manufacturer’s instruction, and treated with DNase (TaKaRa, Dalian, China). The AccuScript High Fidelity First Strand cDNA Synthesis Kit (Stratagene) was used to synthesize first strand cDNA. A partial cDNA fragment was isolated firstly by RT-PCR with a pair of degenerate primer (DP1 and DP2: 5’CAGGCACTACAGGTTTGCCNAARGGNGT 3’ and 5’ATCCAATGTCTCCAGTRTGNAG CCANCC3’; R means A or G; N means A, C, G, T) and LA-Tag polymerase adding high GC buffer (TaKaRa).

The extension of the 3’-cDNA end was performed with a 3’ anchor primer (5’GACCACGCG TATCGATGGCTCA3’) and a sense primer (5’GGCTATGGGATGACCGAGGCT3’). 5’-RACE was carried out according to the protocol of the 5’-full RACE core set (TaKaRa). Gene-specific primer GSP1 (5’ GCAGCACCGAGTTGA 3’) was used for reverse transcription, and then the first and second round PCR was performed with a set of nested primers L1/R1 (5’TTCGGGTTCTCCCCATCCAC3’/5’ CTGTGTGTGCTGCCGCTGTT3) and L2/R2 (5’TGACCAGGCTGCGGTGCGT3’/5’ TGCCGCTGTTCCACATCTACTCG 3’) respectively. The full length of the open reading frame (ORF) of Na4CL was further confirmed with gene -specific primers 4CLF/4CLR(5’ATACATATGGGCTCCATCGCGGCA3’ an 5’ACCCTCGAGTTAGCTTTTGGACTGTG3’). PCR products were subsequently cloned into the pMD19 vector (TaKaRa) and then sequenced.

The extension of 5’-flanking region was carried out according to the protocol of GeneWalker Universal Kit (Clontech). Isolated genomic DNA from young shoots of Neosinocalamus affinis was digested with four restriction enzymes (DraI, EcoRV, PvuII, and StuI, respectively), and then ligated to a GenomeWalker adaptor. The primary PCR was performed with a gene-specific primer (P1: 5’TAGGTGTACACCGCCCCGCTCT3’) and the outer adaptor primer (AP1: 5’GTAATACGACTCACTATAGGGC3’), and then the secondary PCR was preformed with nested gene‐specific primer (P2: 5’CTCCTCTGCCGCGATGGAGCCC3’) and the nested adaptor primer (AP2: 5’ACTATAGGGCACGCGTGGT3’). The secondary PCR products were cloned into pMD19 Vector (TaKaRa) and then sequenced.

Multiple alignments were performed by ClustalW. A phylogenetic tree was generated with MEGA 4.0 based on deduced protein sequences of plant 4CL homologs. The protein three-dimensional structure was simulated using SWISS MODEL and RasMol software. Putative cis-acting elements were identified by Plantcare database (http://bioinformatics.psb.ugent.be/webtools/plantcare/html).

Total RNAs were extracted from various tissues using Trizol reagent following the protocol provided by the manufacturer (Invitrogen, Carlsbad, CA) and treated with DNase (TaKaRa, Dalian, China). About 1 μg of total RNA was used for first-strand cDNA synthesis. RT-PCR was performed using a pair of speciﬁc oligonucleotide primer (P11 and P12: 5’GAGACATCGGTTATGTTGACGA3’ and 5’GGAATCCGTGAAGAAAACTTTG3’) derived from 3’ -end of the Na4CL cDNA. A partial housekeeping Actin cDNA (JN869246) was employed as internal control using gene-specific primers (P21 and P22: 5’ gtattgtcagcaactgggatga 3’ and 5’ gcgtacaaggaaagaacagctt 3’). Real-time quantitative PCR reaction was performed using SYBR Green PCR Master Mix (Applied Biosystem) and each sample was amplified in triplicate. REST software was used to quantify mRNA level of Na4CL with actin normalization by the 2-Ct method.

For a Na4CL RNAi construct, an inverted repeat construct with ~600-bp sequence (spanning from 600~1264 bp downstream of the initial codon of Na4CL ORF) was generated via pSK-int vector and inserted into pBI121 vector. Tobacco transformation was performed as described by Horsch et al. (1985). Kanamycin-resistent transformants were identified by PCR using primers for NPTII (5’-TGAATGAACTGCAGGACGAG-3’ and 5’-AGCCAACGCTATGTCCTGAT-3’). The expression of endogenesis tobacco Nt4CL1 (U50845) was detected using primers 5’-ACCATAGCCACAATGCCAAT-3’ and 5’-CGTCAACATCACACCTTTCG-3’. The tobacco Actin (JQ435884) was amplified as a control using primers 5’-TACAACGAGCTTCGT GTTGC-3’ and 5’-TTGATCTTCATGCTGCTTGG-3’.

Fresh freehand sections from the bottom of stems in tobaccos (12-week old) were subjected to lignin staining using the 0.1% phloroglucinol-HCl (Li et al. 2003). For analysis of lignin content, leaves and stems of transgenic tobaccos were ground with liquid nitrogen, and non-covalently-bound compounds were sequentially removed by successive extractions with 80% ethanol at room temperature. The obtained material was called Cell-Wall Residue (CWR). Lignin content in CWR was estimated by the AcBr method as modiﬁed by Jourdes et al. (2007). Measurements were performed in triplicate.

To isolate a conserved 4CL sequence from Neosinocalamus affinis, a RT-PCR was performed using a pair of degenerate oligonucleotide primers (DP1 and DP2) designed corresponding to highly conserved regions of other plant 4CL sequences. The resulting cDNA sequence of ~700 bp showed significant similarity with other 4CL sequences. To obtain the complete 4CL gene from Neosinocalamus affinis, a series of gene-specific primers and nested primers (see Materials and Methods) were designed targeting the conserved sequence. Subsequently, 3’ and 5'-rapid amplification of cDNA ends (RACE) were performed, separately. In 3’ RACE, five 750~860 bp fragments were cloned, which have similar sequences (87% identity) but with different 3’-UTR length (data not shown), while only a 702 bp cDNA fragment was isolated by 5’ RACE (data not shown).

A non-overlapping cDNA sequence with the length of 1852 bp was obtained through assembling the conserved region and the cDNA fragments from 5’ and 3’ RACE, and then was confirmed by RT-PCR using gene-specific primers (4CLF and 4CLR). The isolated cDNA, designated as Na4CL here (GenBank accession EU327341), contains a complete open reading frame (ORF) of 1674 bp , which encodes a predicted protein of 557 amino acids with a calculated molecular mass of 59.6 kDa and a pI of 5.1.

BLASTp searches showed the Na4CL from Neosinocalamus affinis shares 62~85% amino acid identity with other known plant 4CLs in the GenBank database. Multiple alignments of Na4CL and other characterized 4CL highlighted two conserved motifs that are common to a group of adenylate-forming enzymes (Figure 1; Schmelz and Naismith, 2009). Among them, Box I (SSGTTGLPKGV) is conserved in all known 4CLs, and is considered as the putative AMP binding domain (Uhlmann and Ebel, 1993; Stuible and Kombrink, 2001). Another highly conserved motif, Box II (GEICIRG), has been proposed to be associated with stability and catalytic activity of 4CL and related enzymes (Schmelz and Naismith, 2009). As is clear from the presence of conserved sequences, Na4CL might be a member of the ANL superfamily of adenylating enzymes. However, L (Leu) in the common SSGTTGLPKGV motif of 4CLs is substituent by M (Met) in Na4CL protein, and it is not known whether this amino acid-substituent has any impact on the function of Na4CL.

Phylogenetic analysis previously had shown that most 4CL homologs in dicot could be divided into two distinct group, 4CL class I and class II (Ehlting et al. 1999; Ehlting et al. 2001; Lindermayr et al. 2002). In general, class I 4CLs (such as Arabidopsis At4CL1 and 2) are probably associated with lignin accumulation, while class II 4CLs (such as At4CL3, soybean Gm4CL3 and 4) are assigned to flavonoid branches of phenylpropanoid metabolism (Lindermayr et al. 2002). However, because monolignol compositions and phenylpropanoid proﬁle in monocotyledons are different from those of dicots, the differentiation between evolutionary distance and metabolic function is not certain for isoenzymes of 4CLs in monocots (Hatﬁeld et al. 2008; Hatﬁeld et al. 2009). In phylogenetic tree, bamboo Na4CL clustered closely with Lolium perenne Lp4CL2, Zea mays Zm4CL, Oryza sativa Os4CL1 and Os4CL4, suggesting that 4CLs in monocots likely had more functional conservation (Figure 2).

Structural comparisons revealed that the overall fold is highly conserved among ANL enzymes (Hu et al. 2010). The predicted structure overall structure of Na4CL is similar to that of Populus tomentosa 4CL1 with resolved crystal structure by X-ray diffraction (Pt4CL1; PDB id: 3A9U; Hu et al. 2010). Na4CL contains two distinct N- and C-domains, and the N- domain is composed of N1, N2, and N3 subdomains, which is much larger than that of the C-domain (Figure 3). The major conserved SSGTTGLPKGV motif as a putative AMP-binding domain is located at the position of N3 domain (Figure 3).

To isolate the 5’-flanking region of Na4CL gene, a genomic DNA walking strategy was performed by using gene-specific primers (P1 and P2) and adapter primers (APs) derived from the Na4CL cDNA sequence and its promoter region, respectively (see Materials and Methods), and yielded a DNA clone that contains a 420-bp 5’-upstream sequence and a 176-bp coding region of Na4CL gene. A putative TATA box (TATATTAA), a core element in eukaryotic promoter, was located at -137 bp relative to the ATG translation initiation site (Figure 4, boxed).

AC-rich cis-acting elements, such as ‘P’ and ‘L’ boxes, have been known to be highly conserved in the promoter regions of a number of known 4CL genes (Hauffe et al. 1991; Hamberger and Hahlbrock, 2004). Furthermore, these AC elements, which have been shown to match the binding sites of MYB-related transcription factors, also conserved in the promoters of other phenylpropanoid pathway genes, including phenylalanine ammonialyase (PAL), cinnamate 4-hydroxylase (C4H) and caffeicacid-3-O-methyltransferase (COMT) (Hatton et al. 1995; Raes et al. 2003; Deluc et al. 2006; Legay et al. 2007; Fornalé et al. 2010). Accumulated researches demonstrated that cis-elements P (C/TTT/CC/TA/CA/CCA/CAA/CCC/AC/AC) and L (T/CCT/CC/TACCTACC) boxes, together with another common box A (C/ACGTCT/C), were required for UV- and stress-elicitor responses, and this combination of cis-elements were assumed to be related with coordinate expression of lignin-biosynthetic genes in various stimulus conditions (Logemann et al. 1995; Koopmann et al. 1999). In this study, Plantcare program analysis revealed two box A-like sequences (CCGTCC, underline in Figure 4) and an AC-II element (ACCAACC, underline in Figure 4) present in Na4CL promoter, suggesting its roles in lignin biosynthesis.

Numerous studies have been shown that, the expressions of 4CL, and other lignin-involved genes, such as PAL, C4H, and CAD, are directed to lignifying tissues during plant development (Kao et al. 2002; Eudes et al. 2006; Tsai et al. 2006). To investigate the expression pattern of Na4CL gene in Neosinocalamus affinis, a pair of speciﬁc oligonucleotide primer (P11 and P12) was designed from the particular 3’ end region of the Na4CL cDNA. Total RNAs were isolated from young leaves (YL), mature leaves (ML), 15-day old seeding (Se), young stems (YS) in branch, and mature stems (MS) of 3-year old Neosinocalamus affinis plants. RT-PCR analyses showed the Na4CL is expressed both in seeding, stem and leaf, without apparent tissue speciﬁcity, and increased levels of Na4CL mRNA during the later development stage of leaf and stem indicated that Na4CL expression is developmentally regulated (Figure 5).

A Na4CL-RNAi construct resulted in reduced lignin in tobacco transformants

Furthermore, a Na4CL RNAi construct was generated and then was transformed into tobacco. Eight out of 14 kanamycin-resistant transformants exhibited apparent down-regulation in expression of tobacco endogenous 4CL (Nt4CL1) as compared with that of wild type (Figure 6), hinting the Na4CL RNAi construct effectively resulted in gene silence of tobacco endogenous 4CL. Furthermore, analysis of histochemically stained with phloroglucinol-HCl, which specifically reacts with lignin in plant tissues, showed transgenic plants had less red coloration in xylem of stem compared with those of the wild-type (Figure 6). These results were supported further by reduced lignin content in these transgenic tobacco lines. As showed in Figure 7, lignin contents both in stems and leaves of 4CL-downregulation transgenic lines (T5, T7, T9~T14) decreased significantly, only accounting for 72.7%~88.1% of the wild-type. These results, together with Na4CL expression pattern and AC elements present in its promoter, indicated that Na4CL might be involved in lignin biosynthesis and be a potential alternative gene for modifying the content of lignin to improve bamboo paper-making efficiency.

ALLINA, S.M.; PRI-HADASH, A.; THEILMANN, D.A; ELLIS, B.E. and DOUGLAS, C.J. (1998). 4-Coumarate:Coenzyme A ligase in hybrid poplar. Properties of native enzymes, cDNA cloning, and analysis of recombinant enzymes. Plant Physiology, vol. 116, no. 2, p. 743-754. [CrossRef]

COSTA, M.A.; BEDGAR, D.L.; MOINUDDIN, S.G.; KIM, K.W.; CARDENAS, C.L.; COCHRANE, F.C.; SHOCKEY, J.M.; HELMS, G.L.; AMAKURA, Y.; TAKAHASHI, H.; MILHOLLAN, J.K.; DAVIN, L.B.; BROWSE, J. and LEWIS, N.G. (2005). Characterization in vitro and in vivo of the putative multigene 4-coumarate:CoA ligase network in Arabidopsis: Syringyl lignin and sinapate/sinapyl alcohol derivative formation. Phytochemistry, vol. 66, no. 17, p. 2072-2091. [CrossRef]

DELUC, L.; BARRIEU, F.; MARCHIVE, C.; LAUVERGEAT, V.; DECENDIT, A.; RICHARD, T.; CARDE, J.P.; MERILLON, J.M. and HAMDI, S. (2006). Characterization of a grapevine R2R3-MYB transcription factor that regulates the phenylpropanoid pathway. Plant Physiology, vol. 140, no. 2, p. 499-511. [CrossRef]

EHLTING, J.; BÜTTNER, D.; WANG, Q.; DOUGLAS, C.J.; SOMSSICH, I.E. and KOMBRINK, E. (1999). Three 4-coumarate: Coenzyme A ligases in Arabidopsis thalianarepresent two evolutionarily divergent classes in angiosperms. The Plant Journal, vol. 19, no. 1, p. 9-20. [CrossRef]

EHLTING, J.; SHIN, J.K. and DOUGLAS, C.J. (2001). Identification of 4-coumarate:Coenzyme A ligase (4CL) substrate recognition domains. The Plant Journal, vol. 27, no. 5, p. 455-465. [CrossRef]

ENDLER, A.; MARTENS, S.; WELLMANN, F. and MATERN, U. (2008). Unusually divergent 4-coumarate:CoA-ligases from Ruta graveolens L. Plant Molecular Biology, vol. 67, no. 4, p. 335-346. [CrossRef]

EUDES, A.; POLLET, B.; SIBOUT, R.; DO, C.T.; SÉGUIN, A.; LAPIERRE, C. and JOUANIN, L. (2006). Evidence for a role of AtCAD 1 in ligniﬁcation of elongating stems of Arabidopsis thaliana. Planta, vol. 225, no. 1, p. 23-39. [CrossRef]

FORNALÉ, S.; SHI, X.; CHAI, C.; ENCINA, A.; IRAR, S.; CAPELLADES, M.; FUGUET, E.; TORRES, J.L.; ROVIRA, P.; PUIGDOMÉNECH, P.; RIGAU, J.; GROTEWOLD, E.; GRAY, J. and CAPARRÓS-RUIZ, D. (2010). ZmMYB31 directly represses maize lignin genes and redirects the phenylpropanoid metabolic ﬂux. The Plant Journal, vol. 64, no. 4, p. 633-644. [CrossRef]

GUI, J.; SHEN, J. and LI, L. (2011). Functional characterization of evolutionarily divergent 4-coumarate:Coenzyme A ligases in rice. Plant Physiology, vol. 157, no. 2, p. 574-586. [CrossRef]

HAMBERGER, B. and HAHLBROCK, K. (2004). The 4-coumarate:CoA ligase gene family in Arabidopsis thaliana comprises one rare, sinapate-activating and three commonly occurring isoenzymes. Proceedings of the National Academy Sciences of the United States of America, vol. 101, no. 7, p. 2209-2214. [CrossRef]

HARDING, S.A.; LESHKEVICH, J.; CHIANG, V.L. and TSAI, C.J. (2002). Differential substrate inhibition couples kinetically distinct 4-coumarate:Coenzyme A ligases with spatially distinct metabolic roles in quaking aspen. Plant Physiology, vol. 128, no. 2, p. 428-438. [CrossRef]

HATFIELD, R.; RALPH, J. and GRABBER, J.H. (2008). A potential role for sinapyl p-coumarate as a radical transfer mechanism in grass lignin formation. Planta, vol. 228, no. 6, p. 919-928. [CrossRef]

HATFIELD, R.D.; MARITA, J.M.; FROST, K.; GRABBER, J.; RALPH, J.; LU, F. and KIM, H. (2009). Grass lignin acylation: p-coumaroyl transferase activity and cell wall characteristics of C3 and C4 grasses. Planta, vol. 229, no. 6, p. 1253-1267. [CrossRef]

HATTON, D.; SABLOWSKI, R.; YUNG, M.H.; SMITH, C.; SCHUCH, W. and BEVAN, M. (1995). Two classes of cis sequences contribute to tissue-speciﬁc expression of a PAL2 promoter in transgenic tobacco. The Plant Journal, vol. 7, no. 6, p. 859-876. [CrossRef]

HAUFFE, K.D.; PASZKOWSKI, U.; SCHULZE-LEFERT, P.; HAHLBROCK, K.; DANGL, J.L. and DOUGLAS, C.J. (1991). A parsley 4CL-1 promoter fragment speciﬁes complex expression patterns in transgenic tobacco. The Plant Cell, vol. 3, no. 5, p. 435-443. [CrossRef]

HORSCH, R.B.; FRY, J.E.; HOFFMANN, N.L.; EICHHOLTZ, D.; ROGERS, S.G. and FRALEY, R.T. (1985). A simple and general method for transferring genes into plants. Science, vol. 227, no. 4691, p. 1229-1231. [CrossRef]

HU, W.J.; KAWAOKA, A.; TSAI, C.J.; LUNG, J.; OSAKABE, K.; EBINUMA, H. and CHIANG, V.L. (1998). Compartmentalized expression of two structurally and functionally distinct 4-coumarate:CoA ligase genes in aspen (Populus tremuloides). Proceedings of the National Academy Sciences of the United States of America, vol. 95, no. 9, p. 5407-5412. [CrossRef]

HU, Y.; GAI, Y.; YIN, L.; WANG, X.; FENG, C.; FENG, L.; LI, D.; JIANG, X.N. and WANG, D.C. (2010). Crystal structures of a Populus tomentosa 4-coumarate:CoA ligase shed light on its enzymatic mechanisms. The Plant Cell, vol. 22, no. 9, p. 3093-3104. [CrossRef]

JOURDES, M.; CARDENAS, C.L.; LASKAR, D.D.; MOINUDDIN, S.G.A.; DAVIN, L.B. and LEWIS, N.G. (2007). Plant cell walls are enfeebled when attempting to preservenative lignin conﬁguration with poly-p-hydroxycinnamaldehydes: Evolutionary implications. Phytochemistry, vol. 68, no. 14, p. 1932-1956. [CrossRef]

KAO, Y.Y.; HARDING, S.A. and TSAI, C.J. (2002). Differential expression of two distinct phenylalanine ammonia-lyase genes in condensed tannin-accumulating and lignifying cells of quaking aspen. Plant Physiology, vol. 130, no. 2, p. 796-807. [CrossRef]

KOOPMANN, E.; LOGEMANN, E. and HAHLBROCK, K. (1999). Regulation and functional expression of cinnamate 4-hydroxylase from parsley. Plant Physiology, vol. 119, no. 1, p. 49-56. [CrossRef]

LEGAY, S.; LACOMBE, E.; GOICOECHEA, M.; BRIÈRE, C.; SÉGUIN, A.; MACKAY, J. and GRIMA-PETTENATI, J. (2007). Molecular characterization of EgMYB1, a putative transcriptional repressor of the lignin biosynthetic pathway. Plant Science, vol. 173, no. 5, p. 542-549. [CrossRef]

LI, Y.H.; QIAN, Q.; ZHOU, Y.H.; YAN, M.X.; SUN, L.; ZHANG, M.; FU, Z.M.; WANG, Y.H.; HAN, B.; PANG, X.M.; CHEN, M.S. and LI, J.Y. (2003). BRITTLE CULM1, which encodes a COBRA-Like protein, affects the mechanical properties of rice plants. The Plant Cell, vol. 15, no. 9, p. 2020-2031. [CrossRef]

LINDERMAYR, C.; MÖLLERS, B.; FLIEGMANN, J.; UHLMANN, A.; LOTTSPEICH, F.; MEIMBERG, H. and EBEL, J. (2002). Divergent members of a soybean (Glycine max L.) 4-coumarate:Coenzyme A ligase gene family. European Journal of Biochemistry, vol. 269, no. 4, p. 1304-1315. [CrossRef]

LOGEMANN, E.; PARNISKE, M. and HAHLBROCK, K. (1995). Modes of expression and common structural features of the complete phenylalanine ammonia-lyase gene family in parsley. Proceedings of the National Academy Sciences of the United States of America, vol. 92, no. 13, p. 5905-5909. [CrossRef]

PENG, Z.; LU, T.; LI ,L.; LIU, X.; GAO, Z.; HU, T.; YANG, X.; FENG, Q.; GUAN, J.; WENG, Q.; FAN, D.; ZHU, C.; LU, Y.; HAN, B. and JIANG, Z.H. (2010). Genome-wide characterization of the biggest grass, bamboo, based on 10,608 putative full-length cDNA sequences. BMC Plant Biology, vol. 10, no. 116. [CrossRef]

RAES, J.; ROHDE, A.; CHRISTENSEN, J.H.; VAN DE PEER, Y. and BOERJAN, W. (2003). Genome-wide characterization of the ligniﬁcation toolbox in Arabidopsis. Plant Physiology, vol. 133, no. 3, p. 1051-1071. [CrossRef]

SCHMELZ, S. and NAISMITH, J.H. (2009). Adenylate-forming enzymes. Current Opinion in Structural Biology, vol. 19, no. 6, p. 666-671. [CrossRef]

SILBER, M.V.; MEIMBERG, H. and EBEL, J. (2008). Identification of a 4-coumarate:CoA ligase gene family in the moss, Physcomitrella patens. Phytochemistry, vol. 69, no. 13, p. 2449-2456. [CrossRef]

SOUZA, C.A.; BARBAZUK, B.; RALPH, S.G.; BOHLMANN, J.; HAMBERGER, B. and DOUGLAS, C.J. (2008). Genome-wide analysis of a land plant-speciﬁc acyl:CoenzymeA synthetase (ACS) gene family in Arabidopsis, poplar, rice and Physcomitrella. New Phytologist, vol. 179, no. 4, p. 987-1003. [CrossRef]

STUIBLE, H.P. and KOMBRINK, E. (2001). Identiﬁcation of the substrate speciﬁcity conferring amino acid residues of 4-coumarate:Coenzyme A ligase allows the rational design of mutant enzymes with new catalytic properties. The Journal of Biological Chemistry, vol. 276, no. 29, p. 26893-26897. [CrossRef]

TSAI, C.J.; HARDING, S.A.; TSCHAPLINSKI, T.J.; LINDROTH, R.L. and YUAN, Y. (2006). Genome-wide analysis of the structural genes regulating defense phenylpropanoid metabolism in Populus. New Phytologist, vol. 172, no. 1, p. 47-62. [CrossRef]

UHLMANN, A. and EBEL, J. (1993). Molecular cloning and expression of 4-coumarate:Coenzyme A ligase, an enzyme involved in the resistance response of soybean (Glycine max L.) against pathogen attack. Plant Physiology, vol. 102, no. 4, p. 1147-1156. [CrossRef]

ZHANG, X.H. and CHIANG, V.L. (1997). Molecular cloning of 4-coumarate:Coenzyme A ligase in loblolly pine and the roles of this enzyme in the biosynthesis of lignin in compression wood. Plant Physiology, vol. 113, no. 1, p. 65-74. [CrossRef]

Note: Electronic Journal of Biotechnology is not responsible if on-line references cited on manuscripts are not available any more after the date of publication.