Cinnamic acid, ethanol and temperature interaction on coumarate decarboxylase activity and the relative expression of the putative cd gene in D. bruxellensis

María Angélica Ganga*¹ · Francisco Salinas¹ · Cristina Ravanal¹ · Verónica García¹ · Carolina Carrasco² · Claudio Martínez² · Jorge Saavedra³

¹ Universidad de Santiago de Chile, Departamento de Ciencia y Tecnología de los Alimentos, Santiago, Chile

² Universidad de Santiago de Chile, Centro de Estudios en Ciencia y Tecnología de los Alimentos, Santiago, Chile

³ Pontificia Universidad Católica de Valparaíso, Escuela de Ingeniería de Alimentos y Centro Regional de Estudios en Alimentos Saludables, Valparaíso, Chile

*Corresponding author: angelica.ganga@usach.cl

Financial support: This work was supported by Fondecyt grant 1080376.

Keywords: Dekkera/Brettanomyces, cinnamic acids, coumarate decarboxylase, off-flavours, wine.

Dekkera bruxellensis is one of the main contaminating yeasts in wine due to its ability to metabolize cinnamic acids into volatile phenols. This yeast metabolizes p-coumaric acid into 4-vinylphenol through a coumarate decarboxylase (CD) and then transforms it into to 4-ethylphenol (EF) through a vinylphenol reductase. In this work we investigated the influence of the interaction between the concentration of p-coumaric acid, ferulic acid and ethanol as well as growth temperature on the production of CD activity and the expression of a putative gene that codes for this enzymatic activity. For this, a Box Behnken experimental design was used. The concentration of p-coumaric acid (5-26 ppm) and ferulic acid (3-9 ppm) alone did not show any significant effect on any of the studied response variables. However, the interaction between (ethanol concentration * cinnamic acid concentration) and (ethanol concentration * temperature) had a significant statistical effect on the production of CD activity. Additionally, a higher growth temperature negatively affected the expression of the putative cd gene and the production of CD activity. This is the first work that studies the effect of cinnamic acids on the production of CD activity and the relative expression of its putative gene, using natural concentrations of cinnamic acid found in wine.

The genus Dekkera has been described in almost all wine-producing areas (Chatonnet et al. 1992; Rodrigues et al. 2001; Loureiro and Malfeito-Ferreira, 2003; Ganga and Martínez, 2004; Conterno et al. 2006; Suárez et al. 2007). The presence of this yeast in wine is associated with phenolic aromas that negatively influence the sensorial characteristics of the product. The formation of these off-flavours is due the metabolization of cinnamic acids, present in the must, which give rise mainly to 4-ethylphenol (EF) and 4-ethylguaiacol (Chatonnet et al. 1992). The cinnamic acids, in special p-coumaric and ferulic acids, are first decarboxylated to vinyl derivatives by a cinnamic decarboxylase (CD) and then reduced to ethyl derivatives through the action of a vinylphenol reductase (VR) (Chatonnet et al. 1992). Cinnamic acids have an anti-microbial function and therefore all microorganisms that ferment plant products have this type of enzymatic activity (Clausen et al. 1994; Cavin et al. 1997; Cavin et al 1998; Coghe et al. 2004). The majority of yeast species isolated from wines are capable of producing 4-vinylphenol from p-coumaric acid (Chatonnet et al. 1992; Dias et al. 2003), but few can metabolize p-coumaric acid into 4-EF (Chatonnet et al. 1992; Barata et al. 2006; Lopes et al. 2009). Works on D. bruxellensis have mainly focused on its early detection to reduce economic losses (Wedral et al. 2010). Likewise, studies have been carried out to understand the mechanisms of 4-vinylphenol and 4-EF production (Dias et al. 2003; Godoy et al. 2008; Harris et al. 2008; Harris et al. 2009). It has been observed that when D. bruxellensis grows in the presence of cinnamic acids, especially p-coumaric acid, CD activity increases 600 times (Godoy et al. 2008). Higher EF production occurs when the yeast is grown with a lower concentration of ethanol, given that with 15% of ethanol EF production decreases drastically (Dias et al. 2003; Suárez et al. 2007). Likewise, growth temperature also affects the production of volatile phenols where a temperature of between 16 and 22ºC is favourable (Dias et al. 2003; Benito et al. 2009). However, all these factors have been studied separately without considering their interaction or the effect of cinnamic acids in concentrations naturally present in the must.

A partial identification of the gene that codes for CD activity in D. bruxellensis has been described (Harris et al. 2009). In the case of bacteria, the pdc gen of Lactobacillus plantarum which codes for a p-coumarate decarboxylase has also been described. This gene is regulated by the presence of a substrate, the activity of which is 6000 times greater in the presence of p-coumaric acid (Cavin et al. 1997). A similar observation was made with the pad gen that codes for a phenolic acid decarboxylase in Bacillus subtilis (Cavin et al. 1998) which is regulated at the transcriptional level. In S. cerevisiae regulation is at the post-trancriptional level (Clausen et al. 1994). The first enzyme that metabolizes the cinnamic acids in D. anomala was partially purified and has recently been partially sequenced (Harris et al. 2009). Our research group has purified and characterized a CD and vinyl phenol reductase from D. bruxellensis (Godoy et al. 2008). Using bioinformatic analysis our group obtained a partial sequence of the gene that would code for this enzymatic activity (putative cd gene). The objective of the present work was to determine the combined effects of the concentrations of cinnamic acids and ethanol at levels naturally found in wine, and growth temperature on CD activity in D. bruxellensis and the relative expression of the putative cd gene.

Microorganism

D. bruxellensis L-2480 was isolated from a Chilean winery. This strain is maintained in the collection of the Biotechnology and Applied Microbiology Laboratory of the Universidad de Santiago de Chile (LAMAP-USACH).

Culture medium and growth conditions

The yeast D. bruxellensis L-2480 was grown in YPD medium (5 g L^-1 yeast extract, 5 g L^-1 peptone, 20 g L^-1 glucose and 20 g L^-1 agar) for four days at 28ºC. For the assays described in Table 1, flasks containing 300 ml of yeast nitrogen base (Difco, USA) 6.7 g L^-1 and glucose 20 g L^-1 were inoculated with 1 x 10⁶ cells mL^-1. Cinnamic acid and ethanol concentrations were added according to Table 1. Each culture was agitated until a final concentration of 1 x 10⁸ cells mL^-1 was obtained.

Expression of the putative cd gen

Extraction of total RNA and cDNA synthesis. Total RNA extraction was carried out when the cultures reached a density of 1 x 10⁸ cells mL^-1, using the method based on the RNeasy Mini Handbook (Qiagen, USA). Total RNA was subsequently used as a template for the reverse transcription reaction (RT) using the method described by Zhu and Altmann (2005).

Real time PCR (QPCR). The cDNA obtained was used as a template for QPCR. The primers used for the putative cd gene were CD-F (TCTTCCAAGCAGGGATTTTG) and CD-R (CATTCCGCCTCCACTTTTATC) and the act gene was used as a housekeeping gene. The QPCR were performed on a LightCycler 1.5 (Roche, Germany) with 10 μl of 2X Brilliant II SYBR Green QPCR Master mix (Stratagene, USA), 0.1 mg mL^-1 of BSA (New England BioLabs, USA) and 0.5 μM of each primer in a final volume of 20 μl. The program used was 95ºC for 10 min, 30 cycles at 95ºC for 30 sec, 55ºC for 30 sec and 72ºC for 30 sec, a denaturing analysis at 95ºC for 0 sec, 65ºC for 15 sec and 95ºC for 0 sec with a temperature increase of 0.1ºC/sec, and a cooling stage at 40ºC for 30 sec. The results were analyzed with the LightCycler 4.0 software (Roche, Germany) and quantification of the relative expression of the putative cd gene was carried out using the mathematical method of Pfaffl (2001).

Determination of protein and enzymatic assays

The protein concentration was determined using the method described by Bradford (1976), with bovine serum albumin as a standard. Determination of coumarate decarboxylase activity (CD) was performed as described previously by Godoy et al. (2008).

Effect of enological factors on the enzymatic activity CD and relative expression of the putative cd gene. Response surface design

A Box Behnken surface design was used to study the effects of concentrations of p-coumaric and ferulic acids, ethanol and growth temperature on CD activity and the relative expression of the putative cd gene. The levels of each variable under study are described in Table 1. The concentrations of p-coumaric and ferulic acids used for our assays were determined by quantifying these acids in Chilean wines of the Cabernet Sauvignon variety (data not shown). This design allowed for assaying the four factors and their interactions in a 24-set block with the experimental conditions and three central points. The experiments were conducted at random according to an order provided by the Statgraphics 16 program. The same program was used to analyze the experimental design (StatPoint Technologies Inc, 2009).

To determine how the interaction of temperature and ethanol, p-coumaric acid and ferulic acid concentrations affect the production of CD activity and the relative expression of the putative cd gene, a Box Behnken statistical experimental design was performed (Montgomery, 2001). The experimental runs and the results are shown in Table 1. This statistical tool allows for determining the effects of the factors under study with a minimum of experiments on the response variables, whether individually or considering them in interaction.

CD activity

The mathematical model of the quantifying CD activity provided by the experimental design explained 91.5% of the total variance (R² adjusted = 86.2%). The Analysis of Variance indicated those variables with significative effect on the production of enzymatic activity at its higher experimental levels Table 2. The simple effects plot Figure 1 shows that an increased ethanol concentration results in increased production of CD activity. However, above a concentration of 6.5%, CD activity production decays. Although the concentration of cinnamic acids alone does not influence the production of CD activity, the interaction between cinnamic acids and growth temperature has a negative effect on the production of this enzymatic activity (data not shown). Within the assayed conditions, the response surface methodology optimization routine found that the optimum conditions to maximize CD activity were temperature of 16ºC, 10% ethanol, 26 ppm of p-coumaric and 9 ppm of ferulic acid, resulting in 39U of enzymatic activity Figure 2a.

Relative expression of the putative cd gene

In this case, the Box Behnken design provided a goodness of fit of 87.1% (R² adjusted = 81.5% of explained variance) Table 3. Considering the F-ratio and p-values, increasing temperature and ethanol concentration had a negative linear effect on the relative expression of the putative cd gene Figure 3. Although the ferulic acid concentration has no statistically significant effect on the response, the simple effects plot shows that the concentration of p-coumaric acid had a slight positive effect on the expression of this gene. The response surface methodology optimization routine found the optimum conditions at 16ºC, 3% ethanol, 26 ppm of p-coumaric acid and 5 ppm of ferulic acid, which maximized the putative cd gene expression Figure 2b.

Yeast of the genus Dekkera/Brettanomyces occurs mainly during aging in barrels (Benito et al. 2009). At this stage, the microorganism is under unfavourable conditions for its development, such as a low nutrient concentration, a high concentration of SO₂, acid pH and a temperature close to 15ºC (Suárez et al. 2007; Brandam et al. 2008, Renouf et al. 2009). Dias et al. (2003) described that a 5% ethanol concentration is adequate to obtain volatile phenols in the culture medium, since an increase in ethanol concentration is detrimental to the yeast population and consequently leads to a decrease in volatile phenols. In our study, all the cultures were grown to a final concentration of 1 x 10⁸ cells mL^-1. However, our result is similar to that obtained by Dias et al. (2003), where although D. bruxellensis presents basal CD activity, it is necessary to add ethanol to the culture medium to increase its production Figure 1. In the case of the putative cd gene expression, an increased ethanol concentration has a negative effect on obtaining transcripts or their mean life. Works with D. bruxellensis have used concentrations above 100 ppm of p-coumaric acid in the growth medium, leading to higher production of volatile phenols, which in turn has been correlated with higher CD activity (Dias et al. 2003; Godoy et al. 2008; Harris et al. 2009). However, since this concentration of cinnamic acids has not been described in wines, we used concentrations known to be present in wine (Karathanos et al. 2008). We determined that under these conditions cinnamic acids do not significantly influence the production of CD activity. However, the interaction of cinnamic acids with growth temperature, and growth temperature with ethanol concentration, as well as ethanol concentration, are highly important variables in the production of CD activity. In the case of the expression of the putative cd gene, it was found that temperature and ethanol were the only variables that have a statistically significant effect on the response variable. Analyzing the assayed growth temperatures (16ºC to 28ºC) shows that the increase of this variable brings about a decrease of CD activity. This differs to that reported by Benito et al. (2009), who indicated that at a temperature of between 20 and 30ºC the yeast consumes the greatest quantity of p-coumaric acid, which is indirectly associated to the presence of higher CD activity production. Some authors have suggested that the presence of p-coumaric and ferulic acids in the culture medium of B. bruxellensis leads to an increase in descarboxylate hydroxycinnamic activity (Dias et al. 2003; Godoy et al. 2008; Harris et al. 2009). These observations suggest that the gene that codes for this enzymatic activity may be induced. In the case of L. plantarum, the pdc gene is inducible with p-coumaric acid, similar to what was observed for the pad gene of B. subtilus which is also induced by ferulic and caffeic acids. The concentration of cinnamic acids used by these authors was over 300 ppm, higher than the concentrations assayed in our work Table 1. All the works described to date have independently studied growth temperature, pH, and ethanol concentration, amongst others without considering their interaction. Through the experimental design used in this study, it was possible to determine the effect of each variable independently as well as their interaction and to define the optimum conditions for the production of CD activity and the expression of the putative cd gene. In general the values of the variable are similar, with the exception of ethanol concentration. Cavin et al. (1998) showed that p-coumaric and ferulic acids induce the expression of the pad gene of B. subtilis, obtaining maximum PAD activity at 10 min after induction. The pad gene will be transcribed as a monocistronic transcriptional unit and subjected to transcriptional regulation involving substrate-mediated induction. By studying the pdc gene of L. plantarum which codes for a p-coumaric acid decarboxylase. Cavin et al. (1997) showed that the pdc mRNA pool was at its maximum after 10 min of incubation with the substrate and decreased rapidly after p-coumaric acid was entirely metabolized. In all our experiments the p-coumaric acid was not metabolized completely with part of it remaining in the culture medium (data not shown). At 22ºC with 10% alcohol, the yeast on average only metabolizes 38% of the p-coumaric acid in the culture medium. While with 3% ethanol, 74% of the initial p-coumaric acid was metabolized by the yeast. This result was also obtained at 16ºC. Salameh et al. (2008) indicated that p-coumaric acid can react with the ethanol in the medium or be absorbed through the yeast wall, which leads to a decrease in the acid concentration in the culture medium. In our case, the lowest quantity of p-coumaric acid was obtained with 3% alcohol in the medium. The slow metabolization of p-coumaric acid in the culture medium is closely related to the growth rate of the yeast, with yeast growth slower at 10% than at 3%.

On the other hand, the culture medium used in this work had a pH of 3.4, at which level the cinnamic acids chemically not disassociated, as well as being lipophilic (Agnolucci et al. 2010). This allows these organic acids to enter the cell by diffusion and be deprotonated within the cell resulting in an acidification of the internal medium. To avoid this, the cell must metabolize them and eliminate the protons formed using a membrane ATPase (Agnolucci et al. 2010). Based on our results, alcohol plays an important role in the entrance of cinnamic acids. Sousa et al. (1996) described that in the case of yeasts, ethanol influences the uptake of the substrate from the culture medium. When the mechanism of removing the substrate is passive diffusion, increased ethanol concentration results in increased consumption of the substrate while when the mechanism involves some type of transporter, ethanol has a negative effect. This suggests that in D. bruxellensis the transport of p-coumaric acid to the cell interior might be mediated by a transporter. Likewise, the presence of ethanol in the culture medium causes variation in the composition of the cellular membrane, which may influence the diffusion of cinnamic acids to the interior of the cell or on the ATPase itself or its surroundings (Chambel et al. 1999). However, more studies are necessary.

AGNOLUCCI, M.; REA, F.; SBRANA, C.; CRISTANI, C.; FRACASSETTI, D.; TIRELLI, A. and NUTI, M. (2010). Sulphur dioxide affects culturability and volatile phenol production by Brettanomyces/Dekkera bruxellensis. International Journal of Food Microbiology, vol. 143, no. 1-2, p. 76-80. [CrossRef]

BARATA, A.; NOBRE, A.; CORREIA, P.; MALFEITO-FERREIRA, M. and LOUREIRO, V. (2006). Growth and 4-ethylphenol production by the yeast Pichia guillermondii in grape juices. American Journal of Enology and Viticulture, vol. 57, no. 2, p. 133-138.

BENITO, S.; PALOMERO, F.; MORATA, A.; CALDERÓN, F. and SUÁREZ-LEPE, J.A. (2009). Factors affecting the hydroxycinnamate decarboxylase/vinylphenol reductase activity of Dekkera/Brettanomyces: application for Dekkera/Brettanomyces control in red wine making. Journal of Food Science, vol. 74, no. 1, p. M15-M22. [CrossRef]

BRADFORD, M.M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry, vol. 72, no. 1-2, p. 248-254. [CrossRef]

BRANDAM, C.; CASTRO-MARTÍNEZ, C.; DÉLIA, M.L.; RAMÓN-PORTUGAL, F. and STREHAIANO, P. (2008). Effect of temperature on Brettanomyces bruxellensis: metabolic and kinetic aspects. Canadian Journal of Microbiology, vol. 54, no. 1, p. 11-18. [CrossRef]

CAVIN, J.F.; BARTHELMEBS, L. and DIVIÈS, C. (1997). Molecular characterization of an inducible p-coumaric acid decarboxylase from Lactobacillus plantarum: gene cloning, transcriptional analysis, overexpression in Escherichia coli, purification and characterization. Applied and Environmental Microbiology, vol. 63, no. 5, p. 1939-1944.

CAVIN, J.F.; DARTOIS, V. and DIVIÈS, C. (1998). Gene cloning, transcriptional analysis, purification and characterization of phenolic acid decarboxylase from Bacillus subtilis. Applied and Environmental Microbiology, vol. 64, no. 4, p. 1466-1471.

CHAMBEL, A.; VIEGAS, C.A. and SÁ-CORREIA, I. (1999). Effect of cinnamic acid on the growth and on plasma membrane H⁺-ATPase activity of Saccharomyces cerevisiae. International Journal of Food Microbiology, vol. 50, no. 3, p. 173-179. [CrossRef].

CHATONNET, P.; DUBOURDIE, D.; BOIDRON, J.N. and PONS, M. (1992). The origin of ethylphenols in wines. Journal of the Science of Food and Agriculture, vol. 60, no. 2, p. 165-178. [CrossRef]

CLAUSEN, M.; LAMB, C.J.; MEGNET, R. and DOERNER, P.W. (1994). PAD1 encodes phenylacrylic acid decarboxylase which confers resistance to cinnamic acid in Saccharomyces cerevisiae. Gene, vol. 142, no. 1, p. 107-112. [CrossRef]

COGHE, S.; BENOOT, K.; DELVAUX, F.; VANDERHAEGEN, B. and DELVAUX, F.R. (2004). Ferulic acid release and 4-vinylguaiacol formation during brewing and fermentation: indications for feruloyl esterase activity in Saccharomyces cerevisiae. Journal of Agricultural and Food Chemistry, vol. 52, no. 3, p. 602-608. [CrossRef]

CONTERNO, L.; JOSEPH, C.M.L.; ARVIK, T.J.; HENICK-KLING, T. and BISSON, L.F. (2006). Genetic and physiological characterization of Brettanomyces bruxellensis strains isolated from wines. American Journal of Enology and Viticulture, vol. 57, no. 2, p. 139-147.

DIAS, L.; PEREIRA-DA-SILVA, S.; TAVARES, M.; MALFEITO-FERREIRA, M. and LOUREIRO, V. (2003). Factors affecting the production of 4-ethylphenol by the yeast Dekkera bruxellensis in enological conditions. Food Microbiology, vol. 20, no. 4, p. 377-384. [CrossRef]

GANGA, M.A. and MARTÍNEZ, C. (2004). Effect of wine yeast monoculture practice on the biodiversity of non-Saccharomyces yeasts. Journal of Applied Microbiology, vol. 96, no. 1, p. 76-83. [CrossRef]

GODOY, L.; MARTÍNEZ, C.; CARRASCO, N. and GANGA, M.A. (2008). Purification and characterization of a p-coumarate decarboxylase and a vinylphenol reductase from Brettanomyces bruxellensis. International Journal of Food Microbiology, vol. 127, no. 1-2, p. 6-11. [CrossRef].

HARRIS, V.; FORD, C.M.; JIRANEK, V. and GRBIN, P.R. (2008). Dekkera and Brettanomyces growth and utilisation of hydroxycinnamic acids in synthetic media. Applied Microbiology and Biotechnology, vol. 78, no. 6, p. 997-1006. [CrossRef]

HARRIS, V.; FORD, C.M.; JIRANEK, V. and GRBIN, P.R. (2009). Survey of enzyme activity responsible for phenolic off-flavour production by Dekkera and Brettanomyces yeast. Applied Microbiology and Biotechnology, vol. 81, no. 6, p. 1117-1127. [CrossRef]

KARATHANOS, V.T.; SYRIMBEI, C.; CHIOU, A.; KARATHANOS, A. and MAKRIS, D.P. (2008). Evolution of benzoate derivatives and their hydroxycinnamate analogues during ageing of white wines in oak barrels. Journal of Food Composition and Analysis, vol. 21, no. 8, p. 667-671.[CrossRef]

LOPES, C.A.; JOFRÉ, V. and SANGORRÍN, M.P. (2009). Spoilage yeasts in Patagonian winemaking: molecular and physiological features of Pichia guilliermondii indigenous isolates. Revista Argentina de Microbiología, vol. 41, no. 3, p. 177-184.

LOUREIRO, V. and MALFEITO-FERREIRA, M. (2003). Spoilage yeasts in the wine industry. International Journal of Food Microbiology, vol. 86, no. 1-2, p. 23-50. [CrossRef].

MONTGOMERY, D.C. (2001). Design and analysis of experiments. John Wiley and sons, 5^th ed. New York. 672 p. ISBN 13 9780471316497.

PFAFFL, M.W. (2001). A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research, vol. 29, no. 9, p. e45. [CrossRef]

RENOUF, V.; MIOT-SERTIER, C.; PERELLO, M.C.; DE REVEL, G. and LONVAUD-FUNEL, A. (2009). Evidence for differences between B. bruxellensis strains originating from an enological environment. International Journal of Wine Research, vol. 1, p. 95-100. [CrossRef]

RODRIGUES, N.; GONÇALVES, G.; PEREIRA-DA-SILVA, S.; MALFEITO-FERREIRA, M. and LOUREIRO, V. (2001). Development and use of a new medium to detect yeasts of the genera Dekkera/Brettanomyces. Journal of Applied Microbiology, vol. 90, no. 4, p. 588-599. [CrossRef]

SALAMEH, D.; BRANDAM, C.; MEDAWAR, W.; LTEIF, R. and STREHAIANO, P. (2008). Highlight on the problems generated by p-coumaric acid analysis in wine fermentations. Food Chemistry, vol. 107, no. 4, p. 1661-1667. [CrossRef]

SOUSA, M.J.; MIRANDA, L.; CÔRTE-REAL, M. and LEÃO, C. (1996). Transport of acetic acid in Zygosaccharomyces bailii: effects of ethanol and their implications on the resistance of the yeast to acidic environments. Applied Environmental Microbiology, vol. 62, no. 9, p. 3152-3157.

SUÁREZ, R.; SUÁREZ-LEPE, J.A.; MORATA, A. and CALDERÓN, F. (2007). The production of ethylphenols in wine by yeasts of the genera Brettanomyces and Dekkera: a review. Food Chemistry, vol. 102, no. 1, p. 10-21. [CrossRef]

WEDRAL, D.; SHEWFELT, R. and FRANK, J. (2010). The challenge of Brettanomyces in wine. LWT-Food Science and Technology, vol. 43, no. 10, p. 1474-1479. [CrossRef]

ZHU, L.J. and ALTMANN, S.W. (2005). mRNA and 18S-RNA coapplication-reverse transcription for quantitative gene expression analysis. Analytical Biochemistry, vol. 345, no. 1, p. 102-109. [CrossRef]