Construction and application of a built-in dual luciferase reporter for microRNA functional analysis

Yanzhen Bi*¹ · Xinmin Zheng¹ · Changwei Shao² · Wen Pan³ · Li Jiang² · Huiwu Ouyang²

¹Hubei Key Laboratory of Animal Embryo Engineering and Molecular Breeding, Institute of Animal Husbandry and Veterinary, Hubei Academy of Agricultural Science, China
²RNA Group, College of Life Science, Wuhan University, China
³The Third Affiliated Hospital of Sun Yat-Sen University, Tianhe District, China

*Corresponding author: biyanzhen@gmail.com

Financial support: This work was funded by a research grant from Hubei Key Laboratory of Animal Embryo Engineering and Molecular Breeding to Y. Z. Bi (2010ZD163).

Keywords: biosensor, luciferase, ligase-independent, miRNA, target.

Background: As key gene regulators, microRNAs post-transcriptionally modulate gene expression via binding to partially complementary sequence in the 3’ UTR of target mRNA. An accurate, rapid and quantitative tool for sensing and validation of miRNA targets is of crucial significance to decipher the functional implications of miRNAs in cellular pathways.
Results: Taking advantage of an improved restriction-free cloning method, we engineered a novel built-in dual luciferase reporter plasmid where Firefly and Renilla luciferase genes were assembled in a single plasmid named “pFila”. This design eliminates the transfection of a separate control plasmid and thus minimizes the time and labor required for miRNA-target sensing assays. pFila consistently produces Firefly and Renilla luciferase activities when transfected into human-, monkey- and mouse-derived mammalian cell systems. Moreover, pFila is capable of recapitulating the interaction of miR-16 and its known target CCNE1 in Hela cells. Additionally, pFila is shown to be a sensitive miR-biosensor by evaluating the inhibition efficiency of endogenous miRNA.
Conclusions: pFila would facilitate miRNA target identification and verification in a rapid and simplified manner. Also, pFila is a sensitive biosensor for active miRNA profiling in vivo.

MicroRNAs are key post-transcriptional regulators of gene expression in a variety of cellular events. They mediate translational repression, and sometimes destabilization, of target mRNAs by directing miRISC (microRNA-induced silencing complex) to imperfect complementary sequences in 3’ UTR (Bartel, 2009). It has been predicted that more than 60% of human genes are putative targets of one or more miRNAs, while it is also suggested that an individual miRNA is capable of regulating multiple target mRNAs (Backes et al. 2010). Consequently, a major challenge in miRNA study is the experimental identification and validation of its functional target(s). Various reporter systems have been developed to probe the interaction between individual miRNA and its target (Lee et al. 2008), of which dual luciferase assay is widely adopted to achieve this end (Brennecke et al. 2005). The current dual luciferase assay encompasses two separate plasmids, one containing the region of interest and the other serving as internal control to normalize transfection variation (Robertson et al. 2010). A major drawback of this system is the tedious steps for preparing and transfecting control vector. A more convenient reporter is desired to simplify the conventional protocol.

In addition, there are several methods, including northern blotting, real-time PCR, microarray and deep sequencing, to quantify miRNAs (Willenbrock et al. 2009). However, these techniques simply output the homeostasis of endogenous miRNAs other than active molecules. Moreover, these approaches are either time-consuming and laborious or cost-ineffective. Therefore, a convenient and quantitative miRNA biosensor is desired to measure functional miRNA in vivo.

In this study, by taking advantage of ligase-free homologous recombination in E. coli, we engineered a novel reporter that integrated Firefly and Renilla luciferase genes (Fluc and Rluc, same below) in a single plasmid. Its expressivity and applicability were further examined to demonstrate that this novel reporter will facilitate the screening and sensing of miRNAs and their targets in a simplified and precise manner.

DNA and RNA oligos

Unless stated elsewhere, all DNA and RNA oligos are presented as 5’→3’ direction. Primers for amplifying Fluc gene were Pf, AAGGATCCAGGTGGCACTTTTCG TGCGATCTGCATCTCAATTAG; Pr, GAAAAATAAACAAATAGGGGTTCCGCGCAC CTCACATGTTCTTTCCTGC (sequence annealing to Fluc gene was shown in boldface; sequence complementary to insertion site on pRL-TK was underlined). 3’ outermost primer P2R was CGAAAAGTGCCACCTGGATCCTT. Sequencing primers for pFila was SF, GATGCACCTG ATGAAATGGG; SR, AGGACAGGTG CCGGCAGCGC. For creation of ApaI site, see details in reference (Wang et al. 2009). RNA oligos were chemically synthesized and purified by Genepharma Co. Ltd., (Shanghai, P.R. China). Human miR16-1 was sense UAGCAGCACGUAAAUAUUGGCG and antisense CGCCAAUAUUUACGUGCUGCUA. Negative control for miRNA mimics was sense UUGUACUACACAAAAGUACUG and antisense CAGUACUUUUGUGUAGUACAA. siRNA against Rluc mRNA was sense GUAGCGCGGUGUAUUAUACdTdT and antisense GUAUAAUACACCGCGCUACdTdT. Methylated anti-miR-16-1 inhibitor CGC CAA UAU UUACGU GCU GCU A, scramble anti-miR control UUG UAC UAC ACA AAA GUA CUG.

Construction of plasmids

pFila was fabricated by bridging-PCR coupled with homologous recombination in bacteria. A duplex bridging PCR was conducted in a 50 µl mixture: Pf 4 µl (250 nM), Pr 2 µl (125 nM), P2R primer 2 µl (125 nM), pGL3-promoter plasmid 1 µl (5 ng), modified pRL-TK plasmid 1 µl (10 ng or 50 ng), 2 mM dNTP 5 µl, 25 mM MgSO₄ 2 µl, 10 x KOD buffer 5 µl, KOD plus 1 µl (1 unit), PCR-grade water 27 µl. The condition was: 95ºC 2 min, 30 cycles of (95ºC 15 sec, 55ºC 30 sec, 68ºC 6.5 min). The PCR products were digested with DpnI (Fermentas, Lithuania) at 37ºC for 2 hrs to destroy methylated plasmids while keeping the nascent DNA intact with the following reaction: PCR products, 26 µl; 10 x Tango buffer 3 µl; Dpn I 1 µl (1 unit). An aliquot of 5 µl digested PCR products were transformed into E. coli DH5α to generate recombinants that were subsequently sequenced to verify the integrity. Pf and Pr primer pair was used to amplify Fluc gene composed of SV40 promoter, Fluc coding region and SV40 late poly(A) signal. Fluc gene was designed to fuse into a modified pRL-TK plasmid downstream of 3’UTR of Rluc and upstream of beta-lactamase gene. For the sequence context of human CCNE1 3’UTR, see details in reference (Wang et al. 2009). The wild-type and mutated human CCNE1 target regions were sub-cloned into pFila with Xba I and Apa I.

Cell culture, transfection and dual luciferase assay

Human cervical carcinoma Hela cells, African green monkey kidney Vero cells and mouse myoblast C2C12 cells were maintained in high glucose DMEM (Invitrogen) supplemented with 10% fetal calf serum (Gibco) at 37ºC and 5% CO₂. 4 x 10⁴ cells were seeded in a 24-well plate one day before transfection. For miRNA mimics and plasmid co-transfection, 1 µl 20 µM chemically synthesized miR16 mimics and 50 ng pFila (pFila-CCNE1-wildtype and pFila-CCNE1-mut1&2) or 50 ng pGL3-promoter (internal control) and pRL-ML plasmids (pRL-ML-CCNE1-wildtype and pRL-ML-CCNE1-mut1&2; 25 ng each) were mixed with 2 µl Lipofectamine2000 (Invitrogen) as transfection complex. For evaluation of endogenous miRNA inhibition with pFila, 20 nM 2’-O-methylated anti-human miR16-1 inhibitor was transfected into Hela cells by 0.5 µl Lipofectamine2000 (Invitrogen), RNAiMAX (Invitrogen), Sofast (Sunmabio, China), Fugene (Roche), respectively. All transfections were performed in three independent experiments with each in triplicate. A DLR^TM Assay (Promega) was adopted to measure luciferase activity in a Glomax luminometer essentially according to manufacturer’s instruction.

Statistical analysis

Luciferase levels were reported as ratio over that observed in control transfections, where Rluc activities were normalized to Fluc activities. The data represented the mean ± S.D. of three independent experiments and were analyzed by Student’s t-test. Differences below p < 0.01 were regarded as significant.

Accession number

The sequence and annotation of pFila has been deposited in Genbank with accession number HQ425563. pFila is freely available upon request.

The complicated procedures of the current dual luciferase reporter assay for miRNA target screening prompted us to upgrade its practicality for simplified manipulations. Specifically, we aimed to integrate Fluc and Rluc genes in a single vector. As restriction sites were not available to sub-clone Fluc gene to pRL-TK plasmid with ligase-dependent method, we adopted an improved restriction-free gene fusion approach inspired by the principle of site-directed mutagenesis (Zheng et al. 2004). As shown in Figure 1a and Figure 1b, a duplex bridging PCR was carried out to produce the 6.4 kb linear fusion fragment with homologous sequences at both 5’ and 3’ ends. The PCR products were digested by DpnI and transformed into E. coli to achieve the circular plasmid based on homologous recombination. Sequencing of the recombinant (named pFila) revealed that Fluc gene had been successfully fused into pRL-TK plasmid at designed location (Figure 1c and Figure 1d; Gene sequence 1).

We then evaluated the expressivity of pFila in different mammalian systems. As presented in Figure 2a, luminescence of pFila was reported in a wide linear range when transfected into human-, mouse- and monkey-sourced cell lines at gradient amounts, indicating that pFila consistently produces luciferases in vivo. This also implies that the ordered assembly of Fluc and Rluc luciferase genes in pRL-TK plasmid does not interfere with their individual expression. Next, the applicability and reproducibility of pFila were examined by recapitulating the regulation of human miR16-1 and its known target CCNE1 (Wang et al. 2009). miR16-1 mimics down-regulated the Rluc activity fused with wild-type CCNE1 3’UTR but not a mutant 3’UTR (Figure 2b); the latter carried altered residues that were introduced in the miR16-1 “seed-pairing” recognition site (Figure 2b). This observation perfectly photocopied the result that was achieved by traditional dual reporter assay (Figure 2b), indicating that pFila as a more convenient reporter is fully applicable to miRNA functional analysis. Finally, we applied pFila carrying the wild-type and mutant 3’TUR of CCNE1 to assessing the blockage efficiency of endogenous miR16-1. 2’-O-methylated anti-miRNA-16-1 RNA oligo was transfected by four types of transfection reagents, i.e. Lipofectamine2000, RNAiMAX, Fugene, Sofast. Inhibition efficacy of endogenous miR16-1 varied, of which RNAiMAX achieved the most potent blocking effect. This assay implies that pFila is a sensitive miRNA biosensor to reflect the level of functional miRNAs. It also suggests that the choice of delivery method is an important determinant when conducting loss-of-function analysis of miRNAs.

In summary, we have successfully engineered a novel dual luciferase plasmid that incorporated Fluc and Rluc genes in a single vector, allowing the simultaneous expression of both luciferase genes. This improvement maintains comparable reproducibility but minimizes the time and labor required in conventional dual luciferase protocol. Furthermore, several lines of evidence were presented to demonstrate its application in miRNA functional analysis. These results indicate that pFila will find its wide application in the screening, identification and validation of miRNA with its potential mRNA targets.

We appreciated the technical assistance from Cell Signaling Lab of Wuhan University.

BACKES, C.; MEESE, E.; LENHOF, H.P. and KELLER, A. (2010). A dictionary on microRNAs and their putative target pathways. Nucleic Acids Research, vol. 38, no. 13, p. 4476-4486. [CrossRef]

BARTEL, D.P. (2009). MicroRNAs: Target recognition and regulatory functions. Cell, vol. 136, no. 2, p. 215-233. [CrossRef]

BRENNECKE, J.; STARK, A.; RUSSELL, R.B. and COHEN, S.M. (2005). Principles of microRNA-target recognition. PLoS Biology, vol. 3, no. 3, p. e85. [CrossRef]

LEE, J.Y.; KIM, S.; HWANG, D.W.; JEONG, J.M.; CHUNG, J.K.; LEE, M.C. and LEE, D.S. (2008). Development of a dual-luciferase reporter system for in vivo visualization of microRNA biogenesis and posttranscriptional regulation. The Journal of Nuclear Medicine, vol. 49, no. 2, p. 285-294. [CrossRef]

ROBERTSON, B.; DALBY, A.B.; KARPILOW, J.; KHVOROVA, A.; LEAKE, D. and VERMEULEN, A. (2010). Specificity and functionality of microRNA inhibitors. Silence, vol. 1, no. 1, p. 10. [CrossRef]

WANG, F.; FU, X.D.; ZHOU, Y. and ZHANG, Y. (2009). Down-regulation of the cyclin E1 oncogene expression by microRNA-16-1 induces cell cycle arrest in human cancer cells. BMB Report, vol. 42, no. 11, p. 725-730.

WILLENBROCK, H.; SALOMON, J.; SØKILDE, R.; BARKEN, K.B.; HANSEN, T.N.; NIELSEN, F.C.; MØLLER, S. and LITMAN, T. (2009). Quantitative miRNA expression analysis: Comparing microarrays with next-generation sequencing. RNA, vol. 15, no. 11, p. 2028-2034. [CrossRef]

ZHENG, L.; BAUMANN, U. and REYMOND, J.L. (2004). An efficient one-step site-directed and site-saturation mutagenesis protocol. Nucleic Acids Research, vol. 32, no. 14, p. e115. [CrossRef]