Electronic Journal of Biotechnology ISSN: 0717-3458
  © 2007 by Universidad Católica de Valparaíso -- Chile
Vol. 10 No. 3, Issue of August 15, 2007
 


Table 1. Property of the newly identified groundnut SSRs.


Sequence ID

Repeat
motifs

Type

Primer ID

Primer sequence
(Foward)

Primer sequence
(Reverse)

CTW-06

(ct)27

perfect

S-01

TGGACTAGACAAGGAACAACCA

GAGCCATGAGCACACAACAC

CTW-06

(ct)4

perfect

 

 

 

CTW-07

(gaa)5

perfect

S-02

TTGTTGCTATTTAGGGTGATTGA

GTGGGACAAGGCTTTGTTGT

CTW-07

(gaa)5

perfect

 

 

 

CTW-07

(aac)5

perfect

 

 

 

CTW-10

(tct)5

perfect

S-03

GCACCAATTTTGTCCCTGAT

AAGGGGTTTGCACGTAAATG

CTW-11

(ca)10(ct)8

compound

S-04

GAACGCCAGTTTACGTCGTC

TTGGGACACTTACCGAAGAGTT

CTW-11

(ct)4

perfect

 

 

 

CTW-13

(ac)53

perfect

S-05

CCGGCTAGAGAATACACACACA

CCGGCTAGAGAATACACACACA

CTW-13

(ca)4

perfect

 

 

 

CTW-13

(ca)4

perfect

 

 

 

CTW-14

(ac)84

perfect

S-06

CCGGCTAGAGAATACACACACA

TCCTCCTTCCTCCTTGAACA

CTW-15

(tct)5

perfect

S-07

GCACCAATTTTGTCCCTGAT

CAGAAGGGGTTTGCACCTAA

CTW-16

(ac)12

perfect

S-08

AAGTCCAAAATGCATGCTCA

GGCTCTGTGTGGTAGGGTGT

CTW-18

(ag)5

perfect

S-09

CGCTGTCCTTATCGAACCAT

CTCTCACTCGCGCTTTCTCT

CTW-18

(ca)4

perfect

 

 

 

CTW-18

(ga)4

perfect

 

 

 

CTW-18

(ga)4

perfect

 

 

 

CTW-19

(gt)32

perfect

S-10

CAAGCCAAAAGTGGAAAACC

TCCTTTTGCTAATGCGGTCT

CTW-19

(gt)4

perfect

 

 

 

CTW-19

(ct)5

perfect

 

 

 

CTW-20

(ct)4tt(ct)9

imperfect

S-11

ATGACGGCAGTAGCAGAAGC

TTGAGGAGAAGACGCTGTTG

CTW-20

(tc)4

perfect

 

 

 

CTW-20

(ct)4

perfect

 

 

 

CTW-21

(caa)3cca(caa)2

imperfect

S-12

TCATTGACCTAGCCGAATCC

GAGGGACCAATTGTTGGTTG

CTW-23

(aac)5

perfect

S-13

TTGTTGCTATTTAGGGTGATTGA

CGTCGTTTGATTCATGTAGCC

CTW-23

(gaa)5

perfect

 

 

 

CTW-23

(gaa)5

perfect

 

 

 

CTW-25

(ca)12

perfect

S-14

AGGCAAACCACTGCAAGAGT

CGCTTCCCTGGGATACTTAG

CTW-26

(ctt)5

perfect

S-15

TGAACGAAAAATGCTAATGTGG

CGCAGAGACGTGTTGAAGAA

CTW-26

(ctt)5

perfect

 

 

 

CTW-26

(ctt)4

perfect

 

 

 

CTW-28

(tc)9

perfect

S-16

TGGTAGTGGAGTCAGAGTGTGTG

GTTGCATTGCCCAACTCTTT

CTW-28

(gt)4

perfect

 

 

 

CTW-29

(ct)16

perfect

S-17

CATTGGAAAGATCCGACGAT

GTTGCAACAACGACGATGG

CTW-29

(ct)4

perfect

 

 

 

CTW-31

(ct)5

perfect

S-18

CAATAAATTCGTCGTAT

GAGAGAAGAGAAGGTTAGAGA

CTW-33

(ct)24

perfect

S-19

GCTCCACTAGTGCCGAAATC

CAGACACCCGGAGGCTTA

CTW-36

(caa)5

perfect

S-20

CACGAACAGCCACTCAAAGA

CTCTGGGGGACTAGCTGTTG

CTW-39

(ct)15

perfect

S-21

AGTCCTACTTGTGGGGGTTG

TCCCTTTTGCAGTGAAATCC

CTW-41

(ac)8(at)5

compound

S-22

CGTGACAAACATGTGCTGCT

TTTTGGAATCTGTTTATGGGAAA

CTW-51

(tgt)4

perfect

S-23

CTGGAAGTGGTCCTGTTGGT

GCTGCTCCTGTCTCTGGAAT

CTW-52

(ga)22

perfect

S-24

GGCAATGCACACGCTACTCT

CGTGAGGCGTGAGAGTTCAT

CTW-54

(aga)7

perfect

S-25

GCTATGCTTTTACCACACCAAA

CCATTCATGGTCATCCCTTC

CTW-54

(ag)4

perfect

 

 

 

CTW-56

(aac)4

perfect

S-26

ACATGAGTGCCCAACTAGCC

TGCAGAGCTTCAACAACCAC

CTW-66

(ca)4

perfect

S-27

ATCCGGCTCACAGTTCAATC

GCCAAGGCTGAAAAGAGTTG

CTW-68

(ttg)4

perfect

S-28

TTGCAAGATGTGCATCAAAA

TGACAAACCAACAAACGACA

CTW-68

(gt)4

perfect

 

 

 

CTW NEW_67

(ttc)15

Perfect

S-29

CACCGCCGCCCGTTTCTTCTCCT

GGGCAACGGCTCGACGGTGGTATC

CTW NEW_67

(cct)5

perfect

S-30

CTTCTTCTTCTTCCCGCCACC

GGCGGGCGACGGGCAAC

CTW NEW_124

(tc)3tt(tc)10tt(tc)4

imperfect

S-31

GGCGGCGATGTAGAACCCTCCAGTAG

ACCGCCATCGCCATCGTTGTTGT

CTW NEW_174

(ct)2cc(ct)19

imperfect

S-32

GCATTCGCGCAGCAACC

CCAGAGTAGAGCGGCAGTCC

CTW NEW_270

(caa)4

perfect

S-33

AGATCGCCGCCCTTACCAAAACCT

AGAAAGCCCCAAAATCGTGAGTAACAT

CTW NEW_263

(tgt)4

perfect

S-34

ACCTTCTTCCGCGCTTGTTTCAG

TCCCAGCTCCGATCCTCATACTTCA

CTW NEW_74

(ga)5

perfect

S-35

GCGGTTGCCTGGGTCGTC

CCGCAATGGAAGTGGGAAAGTAT

CTW NEW_227

(tct)6

perfect

S-36

GGCAACGCGTGGTAGCAGTG

GAGTGAGTGAACCAGAAGGAAGGA

CTW NEW_33

(gt)8

perfect

S-37

GACCGCGGCTCCACTTCTTTCTCT

ACATTCCCCTTTCACCCCTCACAAC

CTW NEW_51

(ga)17

perfect

S-38

GGCAGCGAAGCACCCATTGTTA

GTAGGGTTGCGTTTCGTTTTCTTATCG

CTW NEW_72

(aca)4

perfect

S-39

TCCAAAATCAACCAGAAAGCAGAAGCAGATG

AGGAAGAGAAGCGGAGAGGGAGAGAAG

CTW NEW_204

(ca)7

perfect

S-40

ACCCAACACTAGCCGCCACTGA

GCAACGCCTCCTCCTCTTCCTCTA

CTW NEW_16

(aac)4

perfect

S-41

AGAGTATGCGGAATTTGTGCTGAT

CCCGTTGTTGGTTGTGATGG

CTW NEW_209

(caa)4

perfect

S-42

GAGGGGGCGAACGTTGGACTTG

GCCGGAGCACTTGAGCATTTTT

CTW NEW_7

(aga)6

perfect

S-43

ATTCTTTGGACTCGGGTTCATACTTTG

ACACCATCCCTCACTCTCCTCCATA

CTW NEW_197

(tg)17(ag)17

compound

S-44

GGTGTTGAGGGATGGTTGTTCTAA

CTTTCCCGCCTCTCCCTCTC

CTW NEW_62

(tga)5

perfect

S-45

AGGTGTTGTGGCATTGTTCTTCAT

CGGCGGTAGCGGTAGCGGTTAT

CTW NEW_77

(gaa)8

perfect

S-46

ATGGCGAATCGGAGGGTAGGTT

TCCAATCGTGCGTTTCAATCATCT

CTW NEW_19

(gtt)5

perfect

S-47

ATTCTGAGGCTGCTTCCCAAACT

CTGCCATGTAAGCCGTGAATAAG

CTW NEW_86

(gtt)5

perfect

S-48

ATTCTGAGGCTGCTTCCCAAACT

CTGCCATGTAAGCCGTGAATAAG

CTW NEW_36

(gt)11(ga)7ggaggaa(ga)6

compound

S-49

GGCAGCGAAGCACCCATTGT

CGTTTCGTTTTCTTATCGCACTTC

CTW NEW_241

(aac)4

perfect

S-50

ATGCACGCAACTACAGGAAGATAAC

TGCGCAAGAGAACGGAACAT

CTW NEW_71

(tc)7

perfect

S-51

CCCAATTCGCATAAAAACAGAGAC

CGAGCCGCAATCCAACACT

CTW NEW_74

(ga)5

perfect

S-52

CCCTGAGAATGAAAGAAAGAAACA

CAACCGCAGCGACGATAGATG

CTW NEW_92

(tct)6

perfect

S-53

CACACCCATCCATCTCCTCCATA

TGTCTTTGTTGCTCCTCCCTCATT

CTW NEW_234

(ca)5(ga)35

compound

S-54

GTGTGCCATGTAGGTGTGACTG

GTTTGCCCTCTTGTTTTCTCC

CTW NEW_37

(ag)5

perfect

S-55

ACCCCCAACTGCACTACTATTCATTTT

CGACGCGGCGAGGCTTCC

CTW NEW_202

(tc)16

perfect

S-56

CATAGGCGTCCCATTGCTTACAG

GATTACGCGCTCTTTCATTTG

CTW NEW_252

(ttg)9

perfect

S-57

AGGGCGAAAGGCAGAGGAAGA

AAAGGGGTGAGACAGCCAATAACAT

CTW NEW_231

(tc)5

perfect

S-58

GAGCGAAAGAGAACGAGACAACAA

TCGGGGAGGATCAACCAAATAG

CTW NEW_62

(gtt)4

perfect

S-59

TTGGTGGAAGCCCTAGAGTGAGTGAA

ATGGAAATGAAGCCGATAAGAGA

CTW NEW_92

(tc)5

perfect

S-60

TTGGTGCAGGGATGTAAATG

ATATGGAGGAGATGGATGGGTGTG

CTW NEW_137

(aac)4

perfect

S-61

GAGGAGGCAGAGATAATCAGG

GAGAGGTCTGCTGTTGGGTAT

CTW NEW_166

(tg)6

perfect

S-62

CAAGTGGGGGGTTTATGGTG

CCCCCTCCATCACCCCT

CTW NEW_200

(ag)13a(ag)2

imperfect

S-63

CACCGTGGTATGATCGTTTCTTTT

GTTCGCGTGGGATTGTTTGTGT

CTW NEW_51

(gt)11(ga)7gtgagga(ag)6

compound

S-64

GGCAGCGAAGCACCCATTGT

TCCTTCGACCCTATCTATCAGTATCAC

CTW NEW_67

(ctt)9

perfect

S-65

CGATACCACCGTCGAGC

CAAGAACCCAGAATCAGGAAG

CTW NEW_130

(tg)15

perfect

S-66

ACCCCCATTGAGCGATTTG

AGTCCCATTGCCTTTCTTCTGTAT

CTW NEW_157

(aac)6

perfect

S-67

TCTCCTTCCCGAACAACCCTATTA

ATTGTTGACTTGGCTTCGTTCCTA

CTW NEW_137

(aac)6

perfect

S-68

AATCAAGGTGGCAACTACAGC

AGACACTATACTTGCAACGAGGAT

CTW NEW_17

(ttc)4

perfect

S-69

GGGGAGTCGTGTCAAGCCATTA

ACCCCAAACCCAACCCTCAC

CTW NEW_43

(ttg)5

perfect

S-70

CCTTTCCCATTCCATTAGC

GTCCGAGTTGAGGAACAACAA

CTW NEW_88

(tct)7

perfect

S-71

ACCTCTTTCCCTCTCCTCCATA

TTCCTTGCCTCTGTTGTTTGAT

CTW NEW_139

(ag)6

perfect

S-72

TACAGCCCAAATGGAATGAGAA

GAGTTGGGAAGAAAGGATGAAGAT

CTW NEW_68

(aag)8

perfect

S-73

AGTCCACTGAACCGAACACCAATC

TCCCTACCACCGAACGAAACAAT

CTW NEW_20

(aac)9

perfect

S-74

GCACGCGCTCAGGACAAAT

AGGGCGAAAGGCAGAGGAA

CTW NEW_249

(ttc)4

perfect

S-75

ACACCCTCCTCAACATCAAAT

ATACCCAAGCGAAACAAGAATC

CTW NEW_36

(ga)18

perfect

S-76

ATACTGATAGATAGGGTCGAAGGAGAG

CAACGAAAGAAAAATAAGGACATAGTG

CTW NEW_194

(ct)9

perfect

S-77

CACCCCTCACTACAAGAAAAATAC

ATGGCGGAGAAGAGGGAGGAG

CTW NEW_199

(caa)6taa(caa)4

Imperfect

S-78

TCCAATTCAATCTCACTAAAAACT

CAAAGGGGAGCACGAACATAAG

CTW NEW_193

(ttc)5

perfect

S-79

AAACCACGCAGTCCGAATACA

CTTGATGGGCTTTGGAGATAA

CTW NEW_202

(tct)6

perfect

S-80

GGCGTCCCATTGCTTAC

AGAATGCGTTGATGTTATGAA

CTW NEW_119

(tc)26

perfect

S-81

GCTTCAGTGGTGGGCTCAT

TATCATAGTAAAAAGGTGGGAACAAT

CTW NEW_219

(tgt)4

perfect

S-82

TTGCAAAGTAGCGTTCAGAC

CATGGATGGCAGGACAAT

CTW NEW_271

(ca)15ta(ca)11

Imperfect

S-83

CTTGAACTTATTTTTGGTGGGTGAAC

CAAGGGAGAATGAAGAATGCTAAG

CTW NEW_274

(ga)9

perfect

S-84

CAGCCAATATGTCACAACCCTAAT

CTCCCACTACAAATCTCCAATCAAT

CTW NEW_178

(ct)12cc(ct)14

Imperfect

S-85

AAACTATCACCGACAAAAA

AGAGACATAAGCCGAGAGG

CTW NEW_32

(ttc)14

perfect

S-86

TCCATGAGGGGTTATAGGTGTTT

GGGTGTATTTCTGAAGTTCCATTATC

CTW NEW_67

(ggt)8

perfect

S-87

TCTGAGTTCTGGCTTTTGAT

CACCACCACCATCATCATCAT

CTW NEW_128

(ag)43

perfect

S-88

TCAAAGAAGCAATAAAAATC

CTCCACCGGCAAGCACCTC

CTW NEW_82

(ct)19

perfect

S-89

ATCTATGGCCGGGTTGGTT

AGGTGGTGGGTAGTGCTTCTG

CTW NEW_231

(ttc)11

perfect

S-90

GAGAGCGAAAGAGAACGAGAC

GAATTGGAATCCATAGCCAT

CTW NEW_162

(ttc)8(tcc)2(ttc)4

compound

S-91

TGAGGGCAGGGGAAGAT

CGTCGGTGGTTGAAGCAGAG

CTW NEW_219

(tgt)4

perfect

S-92

ATTGGCAGATGAAGAAGGA

GGGAAATCAGAGGTGGAATAA

CTW NEW_38

(tg)10(ag)14

compound

S-93

TTGGGGAAATACAGAATAACG

CTCCCACATCCCCACCAT

CTW NEW_185

(ag)25

perfect

S-94

TTCCCAAAAATAGTCAACCA

TCTTCCTCTGCCTTTCATCCA

CTW NEW_40

(ca)5

perfect

S-95

AACCCCAACCATCAAACAAACA

ATGGTATCACTGGGAAATG

CTW NEW_193

(tct)4

perfect

S-96

ATACACATTCCTCTCCATCTCCT

TTTTTCTTCCCTTTCTTCTTTCTA

CTW NEW_206

(ttg)13

perfect

S-97

GAATCGCGTCTCAGGTG

TATTGCTTACGATTATTTTGT

CTW NEW_225

(Ac)7

perfect

S-98

TTAATGAACCCAAATACACA

AGCCAAAACCCTAAAAACTA

CTW NEW_162

(ttc)7

perfect

S-99

GGGCAGGGGAAGATCAATA

ATGAGGGTGAATTGGAATTGG

CTW NEW_74

(ac)5

perfect

S-100

AAGCGCCATATGTGTTTGA

CCCGTCTTGGCTTTCTTCT

CTW NEW_220

(tca)4

perfect

S-101

AGTGCGTTTGGCTCATCA

ATTTCGTTCATTTAGTCCATAGA

CTW NEW_67

(tga)5

perfect

S-102

TCCTGATTCTGGGTTCTTGA

CCATCCACTGCCACTCCAT

CTW NEW_152

(gt)14

perfect

S-103

ATGTGGGAATTATGGGTAGC

ATGGCGTGACAAAAGAATC

CTW NEW_253

(ttg)8

perfect

S-104

GAATCGCGTCTCAGGTGGTTT

TTAGATGAGTATGAAGAGATTAT

CTW NEW_211

(ag)9

perfect

S-105

AAGCTCATTTCATCACAA

CCACAAACGGCTCATCAATC

CTW NEW_78

(gaa)11

perfect

S-106

GCCAGCATAGAAGCATAATAACA

GAGTAATAGTGAATCAATGAGAAGAGG

CTW NEW_277

(gaa)6

perfect

S-107

TTCAATAATCCAAACCTCATCA

CTGTTTGCGTTTTTCTACTCTG

CTW NEW_177

(tc)14(ac)15

compound

S-108

GCTTACATTACACGTCATCTC

CCGAACTTACAGTTAGGAG

CTW NEW_27

(ag)21

perfect

S-109

AAGGGAGCACAATCATA

GAGCACGAGTTCATACAC

CTW NEW_9

(aac)37

perfect

S-110

TTCTAGTAGTAAAAATAAAAACAC

GTCAAAGGGAGGCACGAACATAAGT

CTW NEW_136

(gt)20

perfect

S-111

TGAAAATTAAAACTACCAACTACA

TGCCCCAAGATAACACAAT

CTW NEW_254

(atg)4

perfect

S-112

ACTGCTAGCGTTGTTTTCTTCC

CATTACACCTTCACCAACACCA

CTW NEW_78

(tc)9

perfect

S-113

TTGCATGTAGGAAAGAAAGATT

TTGGATGTGGTGGTGATGT

CTW NEW_133

(ct)12

perfect

S-114

AAGAGACGAAAGTGAGTTAGC

GGGAGCATGTTTAGGGAGAC

CTW NEW_182

(cca)5

perfect

S-115

GGTAATATGCCTTGGTGAC

TTCTTGATAATTCTGTGGAT

CTW NEW_217

(ttc)4

perfect

S-116

GATTTGTTTTCTTCTTCGTTTTT

CATAATCCACTTCGCCCTAAT

CTW NEW_266

(ttg)8

perfect

S-117

GGATAAAATAAGGAATGA

TTGCAAGTAAGTAATACAA

CTW NEW_78

(aat)6

perfect

S-118

TATATGATGCTTGATTGAGACT

CATGTAGAAGGCTTGGAGGGTAT

CTW NEW_217

(ttc)4

perfect

S-119

CTTCTTCGTTCTTCTTCC

ACGCGTTAGTCTCACAGTCA

CTW NEW_35

(tc)25

perfect

S-120

TTCAAACTACATCTCAAACTAT

TGTGCCAGGACCCAAAAT

CTW NEW_8

(aca)4

perfect

S-121

TTCTCAAAGTCTGTCTGG

TTTAGCAATTGGTTCTTA

CTW NEW_32

(gaa)4

perfect

S-122

TTTTTCGATTTTCATGGTTTCTG

TTTCTCTTTCTCCTCATCTTCTGC

CTW NEW_12

(ct)11

perfect

S-123

GTATGGTGACTGTAGTTCTC

AGTGACCAAAATAGAAGC

CTW NEW_103

(tg)12

perfect

 

 

 

CTW NEW_104

(tgt)15

perfect

 

 

 

CTW NEW_12

(cgc)4

perfect

 

 

 

CTW NEW_171

(aac)6

perfect

 

 

 

CTW NEW_184

(tc)24

perfect

 

 

 

CTW NEW_190

(ttg)7

perfect

 

 

 

CTW NEW_194

(tc)8

perfect

 

 

 

CTW NEW_215

(gga)4

perfect

 

 

 

CTW NEW_222

(ct)24

perfect

 

 

 

CTW NEW_223

(tg)35

perfect

 

 

 

CTW NEW_227

(ct)21

perfect

 

 

 

CTW NEW_23

(ca)28

perfect

 

 

 

CTW NEW_257

(tg)26

perfect

 

 

 

CTW NEW_259

(tg)11(ag)13tg(ag)10

compound

 

 

 

CTW NEW_277

(gaa)4gga
(gaa)gag
(gaa)6cgc
(gaa)taga
(gaa)40

imperfect

  

 

 

CTW NEW_52

(tg)51

perfect

 

 

 

CTW NEW_58

(ct)31

perfect

 

 

 

CTW NEW_67

(tga)4(tgg)7

compound

 

 

 

CTW NEW_68

(agg)4

perfect

 

 

 

CTW NEW_85

(tg)7

perfect

 

 

 

CTW NEW_97

(tc)13

perfect

 

 

 

CTW NEW_98

(tg)12

perfect

 

  

  

  

Supported by UNESCO / MIRCEN network